View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D611-LTR4-TNT-insertion-10 (Length: 367)

Name: D611-LTR4-TNT-insertion-10
Description: D611-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] D611-LTR4-TNT-insertion-10
[»] chr5 (19 HSPs)
chr5 (8-359)||(37704108-37704459)
chr5 (95-359)||(37641318-37641585)
chr5 (95-359)||(37595770-37596037)
chr5 (95-359)||(37713064-37713328)
chr5 (95-359)||(37534546-37534804)
chr5 (87-348)||(37698244-37698505)
chr5 (87-347)||(37430209-37430469)
chr5 (87-252)||(37391389-37391554)
chr5 (87-359)||(37437141-37437413)
chr5 (126-359)||(37380810-37381049)
chr5 (93-254)||(37441491-37441650)
chr5 (130-252)||(37825460-37825582)
chr5 (8-88)||(37437445-37437525)
chr5 (87-351)||(37411754-37412021)
chr5 (8-78)||(37698571-37698641)
chr5 (126-252)||(37399290-37399416)
chr5 (268-359)||(37391584-37391675)
chr5 (269-359)||(37399451-37399541)
chr5 (269-359)||(37825335-37825425)
[»] chr4 (3 HSPs)
chr4 (95-348)||(24216193-24216446)
chr4 (87-348)||(16841327-16841579)
chr4 (22-88)||(16841203-16841272)
[»] chr3 (2 HSPs)
chr3 (95-252)||(14554606-14554760)
chr3 (275-349)||(14554482-14554556)

Alignment Details
Target: chr5 (Bit Score: 344; Significance: 0; HSPs: 19)
Name: chr5

Target: chr5; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 8 - 359
Target Start/End: Complemental strand, 37704459 - 37704108
8 tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatcctaaatcatcaaaatgcggtccttttttattc 107  Q
37704459 tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatcctaaatcatcaaaatgcggtccttttttattc 37704360  T
108 tattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatgatagctccgcctt 207  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37704359 tattgccttattttacttttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatgatagctccgcctt 37704260  T
208 gttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgttcgtctttttcttttaagacagaatcttggaaaacc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
37704259 gttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgtttgtctttttcttttaagacagaatcttggaaaacc 37704160  T
308 ggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
37704159 ggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 37704108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 95 - 359
Target Start/End: Complemental strand, 37641585 - 37641318
95 tccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatg 194  Q
    ||||||||||||| |||||||||||||||  ||||||| || ||||| ||| || ||||||||||||||||||||||||||||| |||||| ||||||||    
37641585 tccttttttattccattgccttattttacctttcacttcttgttgttgttgttgattactcattttacttcctacactttctcactgtgcaaccaacatg 37641486  T
195 atagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacc---cggttttctgtctatgtgttcgtctttttcttttaagac 291  Q
    | | ||| |||||||||||||||||| |||| ||||||||||||||||||||||||||   || | || ||||||  ||| | ||||||||||| |||||    
37641485 acacctctgccttgttacaattcaaaaactctttttctgtcaacacttcatctaaaccggacgatattttgtctagttgtccctctttttctttcaagac 37641386  T
292 agaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    |||||||||||||| |   ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37641385 agaatcttggaaaaacaatacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37641318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 95 - 359
Target Start/End: Complemental strand, 37596037 - 37595770
95 tccttttttattctattgccttattttactcttcacttgttcttgttattg---ctgcttactcattttacttcctacactttctcattgtgcagccaac 191  Q
    ||||||||||||| |||||||||||||||  ||||||| |||||||| |||   |||||||||||||||||||||||||||||||||||||||| | |||    
37596037 tccttttttattccattgccttattttacctttcactttttcttgttgttgttgctgcttactcattttacttcctacactttctcattgtgcaacaaac 37595938  T
192 atgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgt-ctatg--tgttcgtctttttcttttaa 288  Q
    |||| | ||| |||||||||||||||||| |||| ||||||||||||||||||||| |||||     || || || ||  ||||| ||||||||||| ||    
37595937 atgacaactctgccttgttacaattcaaaaactctttttctgtcaacacttcatctcaaccc---aatccgtactttggttgttcctctttttctttcaa 37595841  T
289 gacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    ||||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37595840 gacagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37595770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 95 - 359
Target Start/End: Complemental strand, 37713328 - 37713064
95 tccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatg 194  Q
    ||||||||||||| |||||||||||||||  ||||||| |||| ||| ||| |||||||||||||||||||| ||||||||||| |||||| | ||||||    
37713328 tccttttttattccattgccttattttacctttcacttcttctcgttgttgttgcttactcattttacttcccacactttctcactgtgcaacaaacatg 37713229  T
195 atagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgt-ctatg--tgttcgtctttttcttttaagac 291  Q
    | | ||| |||||||||||||||||| |||| ||||||||||||||||||||| |||||     || || || ||  ||||| ||||||||||| |||||    
37713228 acaactctgccttgttacaattcaaaaactctttttctgtcaacacttcatctcaaccc---aatccgtactttggttgttcctctttttctttcaagac 37713132  T
292 agaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    |||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37713131 agaatcttggcaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37713064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 95 - 359
Target Start/End: Complemental strand, 37534804 - 37534546
95 tccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatg 194  Q
    ||||||||||||| |||||||||||||||  ||||||| |||||||| ||| || ||||||||||||||||||||||||||||| |||||| | ||||||    
37534804 tccttttttattccattgccttattttacctttcactttttcttgttgttgttgattactcattttacttcctacactttctcactgtgcaacaaacatg 37534705  T
195 atagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgttcgtctttttcttttaagacaga 294  Q
    | | ||| |||||||||||||||||| |||| |||||||||| |||||||||| ||| |  |||      |  | |||| ||||||||||| ||||||||    
37534704 acaactctgccttgttacaattcaaaaactctttttctgtcagcacttcatctcaactctattt------tgcgcgttcttctttttctttcaagacaga 37534611  T
295 atcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    ||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37534610 atcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37534546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 87 - 348
Target Start/End: Complemental strand, 37698505 - 37698244
87 aaatgcggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcag 186  Q
    ||||| ||||||||||||||||||||||||||||| |  ||||||| |||||||| ||| |||||||||||||||||||||||||  ||||||| ||||     
37698505 aaatggggtccttttttattctattgccttattttgcctttcactttttcttgttgttgttgcttactcattttacttcctacacactctcattatgcaa 37698406  T
187 ccaacatgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgttcgtctttttctttt 286  Q
    ||| ||||| || || |||||||||||||||||| |||||||||| || |||||||| ||| |||| | | ||  |||||  ||||| ||||||||||      
37698405 ccatcatgacagttctgccttgttacaattcaaaaactcattttcagttaacacttcgtctcaacctgatatttggtctagatgttcctctttttcttcc 37698306  T
287 aagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacac 348  Q
    | ||||||||||||||||| |   |||||||||||| ||||||||||||||||||| |||||    
37698305 aggacagaatcttggaaaaacaatacagattgttgcaagtgggatggtgtcacgtgtgacac 37698244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 87 - 347
Target Start/End: Complemental strand, 37430469 - 37430209
87 aaatgcggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcag 186  Q
    ||||| ||||||||| | ||||||| |||||| || |  ||||||||||||||||  ||||||| |||| |||||||||||| || || ||| ||||||     
37430469 aaatggggtccttttgttttctatttccttatcttgcctttcacttgttcttgttgatgctgctaactctttttacttcctatacattttcaatgtgcaa 37430370  T
187 ccaacatgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgttcgtctttttctttt 286  Q
     || ||||| || || |||||||||||||||||  | ||||||| | |||||||||||||| |||| ||||||  ||||   ||||| |||||||||||     
37430369 gcatcatgacagttctgccttgttacaattcaagaattcattttttatcaacacttcatctcaacctggtttttggtctcactgttcctctttttctttc 37430270  T
287 aagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgaca 347  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
37430269 aagacagaatcttggaaaaccggcacagattgctgcgagtgggatggtgtcacgtgcgaca 37430209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 87 - 252
Target Start/End: Original strand, 37391389 - 37391554
87 aaatgcggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcag 186  Q
    ||||| ||||||| |||||| ||||||||||||||||  ||||||||||| |||| ||| |||||||||||||||||||||| ||| ||||||||||||     
37391389 aaatggggtccttgtttattttattgccttattttacctttcacttgttcatgttgttgttgcttactcattttacttcctatactctctcattgtgcaa 37391488  T
187 ccaacatgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacc 252  Q
    ||  ||||||||||| |||||| ||||||||||| ||||||||| ||||||||||||||| |||||    
37391489 ccttcatgatagctctgccttgctacaattcaaaaactcattttttgtcaacacttcatcaaaacc 37391554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 87 - 359
Target Start/End: Complemental strand, 37437413 - 37437141
87 aaatgcggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcag 186  Q
    ||||| |||||||||||||||| ||||||| |||| | ||||||||||||| ||| ||| |||||||||| |||||| || ||||||||||||| ||||     
37437413 aaatggggtccttttttattcttttgccttgttttgcccttcacttgttctcgttgttgttgcttactcactttactacccacactttctcattatgcaa 37437314  T
187 ccaacatgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgt-ctatg--tgttcgtctttttct 283  Q
    ||| ||||| | ||| ||||| |||||||||||| |||| |||  | |||||||||||||| |||||     || || || ||  ||||  |||||||||    
37437313 ccatcatgacacctctgccttattacaattcaaaaactcttttcttctcaacacttcatctcaaccc---aatccgtactttggttgtttctctttttct 37437217  T
284 tttaagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    || ||||||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37437216 ttcaagacagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37437141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 126 - 359
Target Start/End: Original strand, 37380810 - 37381049
126 ttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatgatagctccgccttgttacaattcaaacactc 225  Q
    |||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||| |||||||||||  || ||||||||||| |||||| ||||    
37380810 ttcacttgttcttgttgttgttgcttactcattttacttcccacactttctcattgtgcaaccaacatgatacatctgccttgttacatttcaaaaactc 37380909  T
226 attttctgtcaacacttcatctaaacccg------gttttctgtctatgtgttcgtctttttcttttaagacagaatcttggaaaaccggcacagattgt 319  Q
    ||||||| ||||||||||||| ||| |||       ||||  | |||  |||||  |||||||||| |||| ||||||||||||||     |||||||||    
37380910 attttctttcaacacttcatcgaaatccgatatacatttttggcctagatgttccactttttctttcaagatagaatcttggaaaaataatacagattgt 37381009  T
320 tgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    || | |||||||||||||||||||||| || |||| ||||    
37381010 tgtgggtgggatggtgtcacgtgcgactccatgtcagatc 37381049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 93 - 254
Target Start/End: Complemental strand, 37441650 - 37441491
93 ggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaaca 192  Q
    |||||||||||||| ||||||||||||||||  ||||| ||||||| || |||||||||||||||||||||||||| ||||||||| |||| | | ||||    
37441650 ggtccttttttattttattgccttattttacctttcacatgttcttcttgttgctgcttactcattttacttcctatactttctcactgtgaaacaaaca 37441551  T
193 tgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccg 254  Q
    ||| | ||| |||||||||||||||||| ||||  |||| |||||||||||||| |||||||    
37441550 tgacacctctgccttgttacaattcaaaaactc--tttcagtcaacacttcatcgaaacccg 37441491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 130 - 252
Target Start/End: Complemental strand, 37825582 - 37825460
130 cttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatgatagctccgccttgttacaattcaaacactcattt 229  Q
    |||||||||||| ||| || ||||||||||||||||||||||||||||| |||||| | ||||||| | ||| |||||||||||||||||| |||| |||    
37825582 cttgttcttgttgttgttgattactcattttacttcctacactttctcactgtgcaacaaacatgacaactctgccttgttacaattcaaaaactctttt 37825483  T
230 tctgtcaacacttcatctaaacc 252  Q
37825482 tctgtcaacacttcatctaaacc 37825460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 37437525 - 37437445
8 tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatcctaaatcatcaaa 88  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
37437525 tttggtccttgccccttagtttcaagttatgtttcctatataaatagaggctaatcatttggtatatcctaaatcatcaaa 37437445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 87 - 351
Target Start/End: Original strand, 37411754 - 37412021
87 aaatgcggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcag 186  Q
    ||||| |||||| |||| |||||||| | ||||||||  ||||||||||||||||  ||||| |||||||||||||||||||||| |||||||| ||||     
37411754 aaatggggtcctgttttgttctattgtcctattttacctttcacttgttcttgttgctgctgtttactcattttacttcctacaccttctcattatgcaa 37411853  T
187 ccaacatgatagctccgccttgttacaattcaaacactcattttctgtcaa---cacttcatctaaacccggttttctgtctatgtgttcgtctttttct 283  Q
    | | ||||| ||||  |||||||||||||||||  ||| | ||  ||||||   || ||||||| | |  | | ||  | |||  ||||| |||||||||    
37411854 ctatcatgacagctttgccttgttacaattcaagaacttacttcttgtcaatggcatttcatctcagcatgatatttggcctagttgttcctctttttct 37411953  T
284 tttaagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgt 351  Q
    || || ||||| ||||||||||     |||||||||||||||||| ||||||||| ||||||||||||    
37411954 ttgaaaacagattcttggaaaaataatacagattgttgcgagtggtatggtgtcatgtgcgacaccgt 37412021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 37698641 - 37698571
8 tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatccta 78  Q
    |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37698641 tttggtcctttccccgtagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatccta 37698571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 126 - 252
Target Start/End: Original strand, 37399290 - 37399416
126 ttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatgatagctccgccttgttacaattcaaacactc 225  Q
    |||||||||||||||| ||| || |||||||||||||||| |||||||||||| | |||| ||| ||||| | ||| |||||||||||||||||| | ||    
37399290 ttcacttgttcttgttgttgttgattactcattttacttcatacactttctcactatgcaaccatcatgacacctctgccttgttacaattcaaaaattc 37399389  T
226 attttctgtcaacacttcatctaaacc 252  Q
    ||||| |||  |||||||||| |||||    
37399390 attttttgttgacacttcatcaaaacc 37399416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 268 - 359
Target Start/End: Original strand, 37391584 - 37391675
268 gtgttcgtctttttcttttaagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    |||||| ||||||||||| ||||||||||||||||||| | | ||| |||||||| |||||||||||||||||||||||||| |||| ||||    
37391584 gtgttcctctttttctttcaagacagaatcttggaaaaacagtacaaattgttgcaagtgggatggtgtcacgtgcgacaccatgtcagatc 37391675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 269 - 359
Target Start/End: Original strand, 37399451 - 37399541
269 tgttcgtctttttcttttaagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    ||||| ||||||||||| ||||||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37399451 tgttcctctttttctttcaagacagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37399541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 269 - 359
Target Start/End: Complemental strand, 37825425 - 37825335
269 tgttcgtctttttcttttaagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    ||||| ||||||||||| ||||||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37825425 tgttcctctttttctttcaagacagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37825335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 94; Significance: 8e-46; HSPs: 3)
Name: chr4

Target: chr4; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 95 - 348
Target Start/End: Original strand, 24216193 - 24216446
95 tccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatg 194  Q
    ||||||||||||||| ||||| |||| ||  ||||||||||| |||| ||| ||||||||||||||||||| ||||||| |||||| |||| ||| ||||    
24216193 tccttttttattctaatgcctcatttgacctttcacttgttcatgttgttgttgcttactcattttacttcttacacttactcattctgcaaccatcatg 24216292  T
195 atagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgttcgtctttttcttttaagacaga 294  Q
    | || || || ||||||||||||||  ||||||||  |||||||||||||||| |||||| | ||  ||||||||||||  |||||| ||| | ||| ||    
24216293 acagttctgcattgttacaattcaagaactcatttgttgtcaacacttcatctgaacccgatatttggtctatgtgttccactttttatttcaggacgga 24216392  T
295 atcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacac 348  Q
    ||| |||||||  ||  |||||||||||||||||||||| |||| ||| |||||    
24216393 atcctggaaaaatggtgcagattgttgcgagtgggatggggtcatgtgtgacac 24216446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 87 - 348
Target Start/End: Original strand, 16841327 - 16841579
87 aaatgcggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcag 186  Q
    ||||| |||||||||||||| | ||||||| |||| | ||||||||||||||  |  ||||||||||||| ||||||||  ||||||| ||||| ||||     
16841327 aaatggggtccttttttattgttttgccttgttttgcccttcacttgttctttgtgctgctgcttactcactttacttcacacactttgtcattctgcaa 16841426  T
187 ccaacatgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgttcgtctttttctttt 286  Q
    ||||||||| ||||| || |||||||| |||||| |||||||||||||||||||||||||| ||         ||   ||| ||||| |||  ||||||     
16841427 ccaacatgacagctctgctttgttacatttcaaaaactcattttctgtcaacacttcatctcaa---------cttgatatttgttcctctacttctttc 16841517  T
287 aagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacac 348  Q
    |||||| |||||||||||| ||| || ||||||||| ||||||||||||||||||| |||||    
16841518 aagacaaaatcttggaaaaacggtacggattgttgcaagtgggatggtgtcacgtgtgacac 16841579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 16841203 - 16841272
22 cttagtttcaggttatgtttcctatataaata---gaggctaatcaattggtatatcctaaatcatcaaa 88  Q
    ||||||||||||||||||||||||||||||||   ||||||||||| |||||||||| ||||||||||||    
16841203 cttagtttcaggttatgtttcctatataaatagaggaggctaatcagttggtatatcgtaaatcatcaaa 16841272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr3

Target: chr3; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 95 - 252
Target Start/End: Complemental strand, 14554760 - 14554606
95 tccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatg 194  Q
    |||||||||||||||||||||||||||||  ||||||| |||||   |||| |||||||||||||||||||||| |||||||||||||||| ||||||||    
14554760 tccttttttattctattgccttattttacctttcactttttctt---attgttgcttactcattttacttcctatactttctcattgtgcaaccaacatg 14554664  T
195 atagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacc 252  Q
    | | ||| |||||||||||||||||| |||| ||||||||||||||||| || |||||    
14554663 acacctctgccttgttacaattcaaaaactctttttctgtcaacacttcttcgaaacc 14554606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 275 - 349
Target Start/End: Complemental strand, 14554556 - 14554482
275 tctttttcttttaagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacacc 349  Q
    ||||||||||| |||||||||||||||||||   | |||||||||||||||||||||||||||||||||||||||    
14554556 tctttttctttcaagacagaatcttggaaaaagagtacagattgttgcgagtgggatggtgtcacgtgcgacacc 14554482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98496 times since January 2019
Visitors: 2275