View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D611-LTR4-TNT-insertion-10 (Length: 367)

Name: D611-LTR4-TNT-insertion-10
Description: D611-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D611-LTR4-TNT-insertion-10
D611-LTR4-TNT-insertion-10
[»] chr5 (19 HSPs)
chr5 (8-359)||(37704108-37704459)
chr5 (95-359)||(37641318-37641585)
chr5 (95-359)||(37595770-37596037)
chr5 (95-359)||(37713064-37713328)
chr5 (95-359)||(37534546-37534804)
chr5 (87-348)||(37698244-37698505)
chr5 (87-347)||(37430209-37430469)
chr5 (87-252)||(37391389-37391554)
chr5 (87-359)||(37437141-37437413)
chr5 (126-359)||(37380810-37381049)
chr5 (93-254)||(37441491-37441650)
chr5 (130-252)||(37825460-37825582)
chr5 (8-88)||(37437445-37437525)
chr5 (87-351)||(37411754-37412021)
chr5 (8-78)||(37698571-37698641)
chr5 (126-252)||(37399290-37399416)
chr5 (268-359)||(37391584-37391675)
chr5 (269-359)||(37399451-37399541)
chr5 (269-359)||(37825335-37825425)
[»] chr4 (3 HSPs)
chr4 (95-348)||(24216193-24216446)
chr4 (87-348)||(16841327-16841579)
chr4 (22-88)||(16841203-16841272)
[»] chr3 (2 HSPs)
chr3 (95-252)||(14554606-14554760)
chr3 (275-349)||(14554482-14554556)


Alignment Details
Target: chr5 (Bit Score: 344; Significance: 0; HSPs: 19)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 8 - 359
Target Start/End: Complemental strand, 37704459 - 37704108
Alignment:
8 tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatcctaaatcatcaaaatgcggtccttttttattc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37704459 tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatcctaaatcatcaaaatgcggtccttttttattc 37704360  T
108 tattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatgatagctccgcctt 207  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37704359 tattgccttattttacttttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatgatagctccgcctt 37704260  T
208 gttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgttcgtctttttcttttaagacagaatcttggaaaacc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
37704259 gttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgtttgtctttttcttttaagacagaatcttggaaaacc 37704160  T
308 ggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
37704159 ggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 37704108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 95 - 359
Target Start/End: Complemental strand, 37641585 - 37641318
Alignment:
95 tccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatg 194  Q
    ||||||||||||| |||||||||||||||  ||||||| || ||||| ||| || ||||||||||||||||||||||||||||| |||||| ||||||||    
37641585 tccttttttattccattgccttattttacctttcacttcttgttgttgttgttgattactcattttacttcctacactttctcactgtgcaaccaacatg 37641486  T
195 atagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacc---cggttttctgtctatgtgttcgtctttttcttttaagac 291  Q
    | | ||| |||||||||||||||||| |||| ||||||||||||||||||||||||||   || | || ||||||  ||| | ||||||||||| |||||    
37641485 acacctctgccttgttacaattcaaaaactctttttctgtcaacacttcatctaaaccggacgatattttgtctagttgtccctctttttctttcaagac 37641386  T
292 agaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    |||||||||||||| |   ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37641385 agaatcttggaaaaacaatacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37641318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 95 - 359
Target Start/End: Complemental strand, 37596037 - 37595770
Alignment:
95 tccttttttattctattgccttattttactcttcacttgttcttgttattg---ctgcttactcattttacttcctacactttctcattgtgcagccaac 191  Q
    ||||||||||||| |||||||||||||||  ||||||| |||||||| |||   |||||||||||||||||||||||||||||||||||||||| | |||    
37596037 tccttttttattccattgccttattttacctttcactttttcttgttgttgttgctgcttactcattttacttcctacactttctcattgtgcaacaaac 37595938  T
192 atgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgt-ctatg--tgttcgtctttttcttttaa 288  Q
    |||| | ||| |||||||||||||||||| |||| ||||||||||||||||||||| |||||     || || || ||  ||||| ||||||||||| ||    
37595937 atgacaactctgccttgttacaattcaaaaactctttttctgtcaacacttcatctcaaccc---aatccgtactttggttgttcctctttttctttcaa 37595841  T
289 gacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    ||||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37595840 gacagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37595770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 95 - 359
Target Start/End: Complemental strand, 37713328 - 37713064
Alignment:
95 tccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatg 194  Q
    ||||||||||||| |||||||||||||||  ||||||| |||| ||| ||| |||||||||||||||||||| ||||||||||| |||||| | ||||||    
37713328 tccttttttattccattgccttattttacctttcacttcttctcgttgttgttgcttactcattttacttcccacactttctcactgtgcaacaaacatg 37713229  T
195 atagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgt-ctatg--tgttcgtctttttcttttaagac 291  Q
    | | ||| |||||||||||||||||| |||| ||||||||||||||||||||| |||||     || || || ||  ||||| ||||||||||| |||||    
37713228 acaactctgccttgttacaattcaaaaactctttttctgtcaacacttcatctcaaccc---aatccgtactttggttgttcctctttttctttcaagac 37713132  T
292 agaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    |||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37713131 agaatcttggcaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37713064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 95 - 359
Target Start/End: Complemental strand, 37534804 - 37534546
Alignment:
95 tccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatg 194  Q
    ||||||||||||| |||||||||||||||  ||||||| |||||||| ||| || ||||||||||||||||||||||||||||| |||||| | ||||||    
37534804 tccttttttattccattgccttattttacctttcactttttcttgttgttgttgattactcattttacttcctacactttctcactgtgcaacaaacatg 37534705  T
195 atagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgttcgtctttttcttttaagacaga 294  Q
    | | ||| |||||||||||||||||| |||| |||||||||| |||||||||| ||| |  |||      |  | |||| ||||||||||| ||||||||    
37534704 acaactctgccttgttacaattcaaaaactctttttctgtcagcacttcatctcaactctattt------tgcgcgttcttctttttctttcaagacaga 37534611  T
295 atcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    ||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37534610 atcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37534546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 87 - 348
Target Start/End: Complemental strand, 37698505 - 37698244
Alignment:
87 aaatgcggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcag 186  Q
    ||||| ||||||||||||||||||||||||||||| |  ||||||| |||||||| ||| |||||||||||||||||||||||||  ||||||| ||||     
37698505 aaatggggtccttttttattctattgccttattttgcctttcactttttcttgttgttgttgcttactcattttacttcctacacactctcattatgcaa 37698406  T
187 ccaacatgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgttcgtctttttctttt 286  Q
    ||| ||||| || || |||||||||||||||||| |||||||||| || |||||||| ||| |||| | | ||  |||||  ||||| ||||||||||      
37698405 ccatcatgacagttctgccttgttacaattcaaaaactcattttcagttaacacttcgtctcaacctgatatttggtctagatgttcctctttttcttcc 37698306  T
287 aagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacac 348  Q
    | ||||||||||||||||| |   |||||||||||| ||||||||||||||||||| |||||    
37698305 aggacagaatcttggaaaaacaatacagattgttgcaagtgggatggtgtcacgtgtgacac 37698244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 87 - 347
Target Start/End: Complemental strand, 37430469 - 37430209
Alignment:
87 aaatgcggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcag 186  Q
    ||||| ||||||||| | ||||||| |||||| || |  ||||||||||||||||  ||||||| |||| |||||||||||| || || ||| ||||||     
37430469 aaatggggtccttttgttttctatttccttatcttgcctttcacttgttcttgttgatgctgctaactctttttacttcctatacattttcaatgtgcaa 37430370  T
187 ccaacatgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgttcgtctttttctttt 286  Q
     || ||||| || || |||||||||||||||||  | ||||||| | |||||||||||||| |||| ||||||  ||||   ||||| |||||||||||     
37430369 gcatcatgacagttctgccttgttacaattcaagaattcattttttatcaacacttcatctcaacctggtttttggtctcactgttcctctttttctttc 37430270  T
287 aagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgaca 347  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
37430269 aagacagaatcttggaaaaccggcacagattgctgcgagtgggatggtgtcacgtgcgaca 37430209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 87 - 252
Target Start/End: Original strand, 37391389 - 37391554
Alignment:
87 aaatgcggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcag 186  Q
    ||||| ||||||| |||||| ||||||||||||||||  ||||||||||| |||| ||| |||||||||||||||||||||| ||| ||||||||||||     
37391389 aaatggggtccttgtttattttattgccttattttacctttcacttgttcatgttgttgttgcttactcattttacttcctatactctctcattgtgcaa 37391488  T
187 ccaacatgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacc 252  Q
    ||  ||||||||||| |||||| ||||||||||| ||||||||| ||||||||||||||| |||||    
37391489 ccttcatgatagctctgccttgctacaattcaaaaactcattttttgtcaacacttcatcaaaacc 37391554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 87 - 359
Target Start/End: Complemental strand, 37437413 - 37437141
Alignment:
87 aaatgcggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcag 186  Q
    ||||| |||||||||||||||| ||||||| |||| | ||||||||||||| ||| ||| |||||||||| |||||| || ||||||||||||| ||||     
37437413 aaatggggtccttttttattcttttgccttgttttgcccttcacttgttctcgttgttgttgcttactcactttactacccacactttctcattatgcaa 37437314  T
187 ccaacatgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgt-ctatg--tgttcgtctttttct 283  Q
    ||| ||||| | ||| ||||| |||||||||||| |||| |||  | |||||||||||||| |||||     || || || ||  ||||  |||||||||    
37437313 ccatcatgacacctctgccttattacaattcaaaaactcttttcttctcaacacttcatctcaaccc---aatccgtactttggttgtttctctttttct 37437217  T
284 tttaagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    || ||||||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37437216 ttcaagacagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37437141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 126 - 359
Target Start/End: Original strand, 37380810 - 37381049
Alignment:
126 ttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatgatagctccgccttgttacaattcaaacactc 225  Q
    |||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||| |||||||||||  || ||||||||||| |||||| ||||    
37380810 ttcacttgttcttgttgttgttgcttactcattttacttcccacactttctcattgtgcaaccaacatgatacatctgccttgttacatttcaaaaactc 37380909  T
226 attttctgtcaacacttcatctaaacccg------gttttctgtctatgtgttcgtctttttcttttaagacagaatcttggaaaaccggcacagattgt 319  Q
    ||||||| ||||||||||||| ||| |||       ||||  | |||  |||||  |||||||||| |||| ||||||||||||||     |||||||||    
37380910 attttctttcaacacttcatcgaaatccgatatacatttttggcctagatgttccactttttctttcaagatagaatcttggaaaaataatacagattgt 37381009  T
320 tgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    || | |||||||||||||||||||||| || |||| ||||    
37381010 tgtgggtgggatggtgtcacgtgcgactccatgtcagatc 37381049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 93 - 254
Target Start/End: Complemental strand, 37441650 - 37441491
Alignment:
93 ggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaaca 192  Q
    |||||||||||||| ||||||||||||||||  ||||| ||||||| || |||||||||||||||||||||||||| ||||||||| |||| | | ||||    
37441650 ggtccttttttattttattgccttattttacctttcacatgttcttcttgttgctgcttactcattttacttcctatactttctcactgtgaaacaaaca 37441551  T
193 tgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccg 254  Q
    ||| | ||| |||||||||||||||||| ||||  |||| |||||||||||||| |||||||    
37441550 tgacacctctgccttgttacaattcaaaaactc--tttcagtcaacacttcatcgaaacccg 37441491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 130 - 252
Target Start/End: Complemental strand, 37825582 - 37825460
Alignment:
130 cttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatgatagctccgccttgttacaattcaaacactcattt 229  Q
    |||||||||||| ||| || ||||||||||||||||||||||||||||| |||||| | ||||||| | ||| |||||||||||||||||| |||| |||    
37825582 cttgttcttgttgttgttgattactcattttacttcctacactttctcactgtgcaacaaacatgacaactctgccttgttacaattcaaaaactctttt 37825483  T
230 tctgtcaacacttcatctaaacc 252  Q
    |||||||||||||||||||||||    
37825482 tctgtcaacacttcatctaaacc 37825460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 37437525 - 37437445
Alignment:
8 tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatcctaaatcatcaaa 88  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
37437525 tttggtccttgccccttagtttcaagttatgtttcctatataaatagaggctaatcatttggtatatcctaaatcatcaaa 37437445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 87 - 351
Target Start/End: Original strand, 37411754 - 37412021
Alignment:
87 aaatgcggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcag 186  Q
    ||||| |||||| |||| |||||||| | ||||||||  ||||||||||||||||  ||||| |||||||||||||||||||||| |||||||| ||||     
37411754 aaatggggtcctgttttgttctattgtcctattttacctttcacttgttcttgttgctgctgtttactcattttacttcctacaccttctcattatgcaa 37411853  T
187 ccaacatgatagctccgccttgttacaattcaaacactcattttctgtcaa---cacttcatctaaacccggttttctgtctatgtgttcgtctttttct 283  Q
    | | ||||| ||||  |||||||||||||||||  ||| | ||  ||||||   || ||||||| | |  | | ||  | |||  ||||| |||||||||    
37411854 ctatcatgacagctttgccttgttacaattcaagaacttacttcttgtcaatggcatttcatctcagcatgatatttggcctagttgttcctctttttct 37411953  T
284 tttaagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgt 351  Q
    || || ||||| ||||||||||     |||||||||||||||||| ||||||||| ||||||||||||    
37411954 ttgaaaacagattcttggaaaaataatacagattgttgcgagtggtatggtgtcatgtgcgacaccgt 37412021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 37698641 - 37698571
Alignment:
8 tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatccta 78  Q
    |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37698641 tttggtcctttccccgtagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatccta 37698571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 126 - 252
Target Start/End: Original strand, 37399290 - 37399416
Alignment:
126 ttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatgatagctccgccttgttacaattcaaacactc 225  Q
    |||||||||||||||| ||| || |||||||||||||||| |||||||||||| | |||| ||| ||||| | ||| |||||||||||||||||| | ||    
37399290 ttcacttgttcttgttgttgttgattactcattttacttcatacactttctcactatgcaaccatcatgacacctctgccttgttacaattcaaaaattc 37399389  T
226 attttctgtcaacacttcatctaaacc 252  Q
    ||||| |||  |||||||||| |||||    
37399390 attttttgttgacacttcatcaaaacc 37399416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 268 - 359
Target Start/End: Original strand, 37391584 - 37391675
Alignment:
268 gtgttcgtctttttcttttaagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    |||||| ||||||||||| ||||||||||||||||||| | | ||| |||||||| |||||||||||||||||||||||||| |||| ||||    
37391584 gtgttcctctttttctttcaagacagaatcttggaaaaacagtacaaattgttgcaagtgggatggtgtcacgtgcgacaccatgtcagatc 37391675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 269 - 359
Target Start/End: Original strand, 37399451 - 37399541
Alignment:
269 tgttcgtctttttcttttaagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    ||||| ||||||||||| ||||||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37399451 tgttcctctttttctttcaagacagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37399541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 269 - 359
Target Start/End: Complemental strand, 37825425 - 37825335
Alignment:
269 tgttcgtctttttcttttaagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgtctgatc 359  Q
    ||||| ||||||||||| ||||||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |||| ||||    
37825425 tgttcctctttttctttcaagacagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacaccatgtcagatc 37825335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 94; Significance: 8e-46; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 95 - 348
Target Start/End: Original strand, 24216193 - 24216446
Alignment:
95 tccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatg 194  Q
    ||||||||||||||| ||||| |||| ||  ||||||||||| |||| ||| ||||||||||||||||||| ||||||| |||||| |||| ||| ||||    
24216193 tccttttttattctaatgcctcatttgacctttcacttgttcatgttgttgttgcttactcattttacttcttacacttactcattctgcaaccatcatg 24216292  T
195 atagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgttcgtctttttcttttaagacaga 294  Q
    | || || || ||||||||||||||  ||||||||  |||||||||||||||| |||||| | ||  ||||||||||||  |||||| ||| | ||| ||    
24216293 acagttctgcattgttacaattcaagaactcatttgttgtcaacacttcatctgaacccgatatttggtctatgtgttccactttttatttcaggacgga 24216392  T
295 atcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacac 348  Q
    ||| |||||||  ||  |||||||||||||||||||||| |||| ||| |||||    
24216393 atcctggaaaaatggtgcagattgttgcgagtgggatggggtcatgtgtgacac 24216446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 87 - 348
Target Start/End: Original strand, 16841327 - 16841579
Alignment:
87 aaatgcggtccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcag 186  Q
    ||||| |||||||||||||| | ||||||| |||| | ||||||||||||||  |  ||||||||||||| ||||||||  ||||||| ||||| ||||     
16841327 aaatggggtccttttttattgttttgccttgttttgcccttcacttgttctttgtgctgctgcttactcactttacttcacacactttgtcattctgcaa 16841426  T
187 ccaacatgatagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacccggttttctgtctatgtgttcgtctttttctttt 286  Q
    ||||||||| ||||| || |||||||| |||||| |||||||||||||||||||||||||| ||         ||   ||| ||||| |||  ||||||     
16841427 ccaacatgacagctctgctttgttacatttcaaaaactcattttctgtcaacacttcatctcaa---------cttgatatttgttcctctacttctttc 16841517  T
287 aagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacac 348  Q
    |||||| |||||||||||| ||| || ||||||||| ||||||||||||||||||| |||||    
16841518 aagacaaaatcttggaaaaacggtacggattgttgcaagtgggatggtgtcacgtgtgacac 16841579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 16841203 - 16841272
Alignment:
22 cttagtttcaggttatgtttcctatataaata---gaggctaatcaattggtatatcctaaatcatcaaa 88  Q
    ||||||||||||||||||||||||||||||||   ||||||||||| |||||||||| ||||||||||||    
16841203 cttagtttcaggttatgtttcctatataaatagaggaggctaatcagttggtatatcgtaaatcatcaaa 16841272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 95 - 252
Target Start/End: Complemental strand, 14554760 - 14554606
Alignment:
95 tccttttttattctattgccttattttactcttcacttgttcttgttattgctgcttactcattttacttcctacactttctcattgtgcagccaacatg 194  Q
    |||||||||||||||||||||||||||||  ||||||| |||||   |||| |||||||||||||||||||||| |||||||||||||||| ||||||||    
14554760 tccttttttattctattgccttattttacctttcactttttctt---attgttgcttactcattttacttcctatactttctcattgtgcaaccaacatg 14554664  T
195 atagctccgccttgttacaattcaaacactcattttctgtcaacacttcatctaaacc 252  Q
    | | ||| |||||||||||||||||| |||| ||||||||||||||||| || |||||    
14554663 acacctctgccttgttacaattcaaaaactctttttctgtcaacacttcttcgaaacc 14554606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 275 - 349
Target Start/End: Complemental strand, 14554556 - 14554482
Alignment:
275 tctttttcttttaagacagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacacc 349  Q
    ||||||||||| |||||||||||||||||||   | |||||||||||||||||||||||||||||||||||||||    
14554556 tctttttctttcaagacagaatcttggaaaaagagtacagattgttgcgagtgggatggtgtcacgtgcgacacc 14554482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC