View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D611-LTR4-TNT-insertion-11 (Length: 867)

Name: D611-LTR4-TNT-insertion-11
Description: D611-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D611-LTR4-TNT-insertion-11
D611-LTR4-TNT-insertion-11
[»] chr7 (1 HSPs)
chr7 (6-858)||(40805975-40806827)
[»] chr8 (1 HSPs)
chr8 (678-858)||(22552026-22552204)
[»] chr1 (1 HSPs)
chr1 (35-135)||(28471351-28471451)


Alignment Details
Target: chr7 (Bit Score: 826; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 826; E-Value: 0
Query Start/End: Original strand, 6 - 858
Target Start/End: Complemental strand, 40806827 - 40805975
Alignment:
6 catcagcgaccttaccggctaatccagggtgataaacaaacgtgacaccaggtcttttcacataagacaacattatagaagtgttgtagtgaacaaaata 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40806827 catcagcgaccttaccggctaatccagggtgataaacaaacgtgataccaggtcttttcacataagacaacattatagaagtgttgtagtgaacaaaata 40806728  T
106 cacattgaaagctttctgatcaataggatatgaaggtatgaaccaatcactaacatttgcattcaaaagctctcctaccccaatatcaatataaaccaac 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40806727 cacattgaaagctttctgatcaataggatatgaaggtatgaaccaatcactaacatttgcattcaaaagctctcctaccccaatatcaatataaaccaac 40806628  T
206 ctcttcntagtagaaacatctacaaacttaggcaaatatgaaaccggcatcggcgtcgtgatagatggtttttcactcacaagaggttccatcagatcta 305  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
40806627 ctcttcctagtagaaacatctacaaacttaggcaaatatgaaaccggcatcggcgtcgtgatatatggtttttcactcacaagaggttccatcagatcta 40806528  T
306 tgagaggtttggttaatgtcaaactaggacaatcagcaggcaaactatactgattatgattgaaaaaagttgttgcattttcggatcttttcttgaaaac 405  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40806527 tgagaggtttggttaatgtcaaactaggacaatcagcaggcaaactatactgattatgattgaaaaaagttgttgcattttcggatcttttcttgaaaac 40806428  T
406 aacaaggttaaggtcatcaccaacagaatcaacatgaacaacactagaagatctcaacaatgatgaaactggtgtagctgatctaatcaaatcattgtga 505  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40806427 aacaaggttaaggtcatcatcaacagaatcaacatgaacaacactagaagatctcaacaatgatgaaactggtgtagctgatctaatcaaatcattgtga 40806328  T
506 tgtgaacttttagcacgaacgagaagtgcaccaattccattaggcttaagaacacgttcaacctcaagaacaagcaaagcaggcacagaaaccttatcaa 605  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
40806327 tgtgaacttttagcacgaacgagaagtgcaccaattccattaggcttaagaacacgttcaacctcaagaacaagcaaagcagggacagaaaccttatcaa 40806228  T
606 ggtccctagacaaaacgaaatcaaatgaagaatcttgataatctagctcataaacgatattcttcatcttgagggagaaaaaacggttggtataaacacc 705  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40806227 ggtccctagacaaaacgaaatcaaatgaagaatcttgataatctagctcataaacgatattcttcatcttgagggagaaaaaacggttggtataaacacc 40806128  T
706 actaacagttgaaaagcccaaccgtttcattgctttaacagccattgaagaaccttcaccagcacaaagggtatttgcttcacagttcaaaaactgctta 805  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
40806127 actaacagttgaaaagcccaactgtttcattgctttaacagccattgaagaaccttcaccaacacaaagggtatttgcttcacagttcaaaaactgctta 40806028  T
806 cccattaactcagtgaccacattcactgtcaagttaacgtctttttcgcaatt 858  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
40806027 cccattaactcagtgaccacattcactgtcaagttaacgtctttttcgcaatt 40805975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 106; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 678 - 858
Target Start/End: Complemental strand, 22552204 - 22552026
Alignment:
678 gggagaaaaaacggttggtataaacaccactaacagttgaaaagcccaaccgtttcattgctttaacagccattgaagaaccttcaccagcacaaagggt 777  Q
    ||||||| ||||||||||||||||||||||  ||| ||||||| |||||  |||||||||||||| ||||| ||||||||||||||||| |||||| |||    
22552204 gggagaagaaacggttggtataaacaccac--acatttgaaaaacccaattgtttcattgctttatcagcccttgaagaaccttcaccaacacaaatggt 22552107  T
778 atttgcttcacagttcaaaaactgcttacccattaactcagtgaccacattcactgtcaagttaacgtctttttcgcaatt 858  Q
    |||||||||||| ||||||||||  |||||||  || ||||||||||||||||||||||||||| ||||||||||||||||    
22552106 atttgcttcacaattcaaaaactctttacccaccaattcagtgaccacattcactgtcaagttaccgtctttttcgcaatt 22552026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 35 - 135
Target Start/End: Original strand, 28471351 - 28471451
Alignment:
35 tgataaacaaacgtgacaccaggtcttttcacataagacaacattatagaagtgttgtagtgaacaaaatacacattgaaagctttctgatcaataggat 134  Q
    ||||||||||| || ||||  |||| |||||| |  |||||||| |||||||||||||| ||||||||||| ||||||||| |||||| || ||| ||||    
28471351 tgataaacaaatgtaacacgcggtcctttcacgtgtgacaacataatagaagtgttgtaatgaacaaaataaacattgaaatctttcttatgaattggat 28471450  T
135 a 135  Q
    |    
28471451 a 28471451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC