View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D611-LTR4-TNT-insertion-14 (Length: 711)

Name: D611-LTR4-TNT-insertion-14
Description: D611-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D611-LTR4-TNT-insertion-14
D611-LTR4-TNT-insertion-14
[»] chr1 (1 HSPs)
chr1 (10-706)||(36452659-36453355)


Alignment Details
Target: chr1 (Bit Score: 685; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 685; E-Value: 0
Query Start/End: Original strand, 10 - 706
Target Start/End: Complemental strand, 36453355 - 36452659
Alignment:
10 cctgaaacgtgaaaagtgttattattgatggaaaataactccatataattcatactatctagcaaggtagctaattaattttcagaccctggtgcctttg 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36453355 cctgaaacgtgaaaagtgttattattgatggaaaataactccatataattcatactatctagcaaggtagctaattaattttcagaccctggtgcctttg 36453256  T
110 aacttcttctcagcctccctactgtcaataactgcatcatggaatccataacgtcctctatcatccctcctataataatcatcatcgtaatcacttgcat 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36453255 aacttcttctcagcctccctactgtcaataactgcatcatggaatccataacgtcctctatcatccctcctataataatcatcatcgtaatcacttgcat 36453156  T
210 catcaatgaacgtggcacgtgtttgtgaatcacgtggtggtgactgaagctggttaacatttccataaggcctcatggcagcaccggaaccagtcctgtc 309  Q
    |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36453155 catcaatgaacgtgacacgtgtttgtgaatcacgtggtcgtgactgaagctggttaacatttccataaggcctcatggcagcaccggaaccagtcctgtc 36453056  T
310 agtaaagcgaggagaggcattacctggagttggactatgttgttgatcacgctttgcagcttccatcttcaacaactccatggccttgtcaatgtcatga 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36453055 agtaaagcgaggagaggcattacctggagttggactatgttgttgatcacgctttgcagcttccatcttcaacaactccatggccttgtcaatgtcatga 36452956  T
410 attggctcgcttaattgagtcccttttcttggtgctgcagtccaatatgaattaatttttggcccattgaaattggatctgttgttgtaataattagcag 509  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36452955 attggctcgcttaattgagtcccttttcttggtgctgcagtccaatatgaattaatttttggcccattgaaattggatctgttgttgtaataattagcag 36452856  T
510 cgttatcaccatcatcatatttaggattgctactacttacaaacggcttatcgttgtggttactaataccatagccgttaccatagttgccgttcctagt 609  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36452855 cgttatcaccatcatcatatttaggattgctactacttacaaacggcttatcgttgtggttactaataccatagccgttaccatagttgccgttcctagt 36452756  T
610 gggcttgtatccttcttttttgttgtagtcactgccatatccattagggctatcatagccatcttgagtactcctcatgctacctactccaattggt 706  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
36452755 gggcttgtatccttcttttttgttgtagtcactgccatatccattagggctatcatagccatcttgagtactccttatgctacctactccaattggt 36452659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC