View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D611-LTR4-TNT-insertion-5 (Length: 310)

Name: D611-LTR4-TNT-insertion-5
Description: D611-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D611-LTR4-TNT-insertion-5
D611-LTR4-TNT-insertion-5
[»] chr5 (3 HSPs)
chr5 (8-301)||(41796999-41797292)
chr5 (88-210)||(41762982-41763104)
chr5 (219-274)||(41793492-41793549)


Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 8 - 301
Target Start/End: Original strand, 41796999 - 41797292
Alignment:
8 ctttcatctagaagaaaccaccgtccttgtgtccttgaaagtactgattcatgcatcatgcataactaaagcaataatacaaagaaaacaaacccgagag 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41796999 ctttcatctagaagaaaccaccgtccttgtgtccttgaaagtactgattcatgcatcatgcataactaaagcaataatacaaagaaaacaaacccgagag 41797098  T
108 gaatgaagaataatgaaaagctgcgttgtaatgttatgagtccacgtttggttgtatcatgtggcaagggtggctcttataattatagagataaattatt 207  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41797099 gaatgaagaataatgaaaagctacgttgtaatgttatgagtccacgtttggttgtatcatgtggcaagggtggctcttataattatagagataaattatt 41797198  T
208 gatcgattggtatggtttagaagaagtcattttctgatgtgtaaaactaagcacatgaacgtgtatgttggaatcgcattgatgaagacaattg 301  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41797199 gatcgattggtatggtttagaagaagtcattttctgatgtgtaaaactaagcacatgaacgtgtatgttggaatcgcattgatgaagacaattg 41797292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 88 - 210
Target Start/End: Original strand, 41762982 - 41763104
Alignment:
88 aaagaaaacaaacccgagaggaatgaagaataatga--aaagctgcgttgtaatgttatgagtccacgtttggttgtatcatgtggcaagggtggctctt 185  Q
    ||||||| |||| | |||| ||||||||||||||||  |||||| | | | |||||||||| ||||||| |||||||||||||||||||||| | | |||    
41762982 aaagaaagcaaatcagagatgaatgaagaataatgatcaaagctacatagcaatgttatgaatccacgtgtggttgtatcatgtggcaagggcgtccctt 41763081  T
186 ataattatagagataaattattgat 210  Q
    |||||| |  |||||||||||||||    
41763082 ataatttt--agataaattattgat 41763104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 219 - 274
Target Start/End: Original strand, 41793492 - 41793549
Alignment:
219 atggtttagaagaagtcattttctgatgtg---taaaactaagcacatgaacgtgtatg 274  Q
    |||||||||| ||||||||||||||||||    ||||||||||||||||||||||||||    
41793492 atggtttaga-gaagtcattttctgatgtagtataaaactaagcacatgaacgtgtatg 41793549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC