View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D611-LTR4-TNT-insertion-6 (Length: 587)

Name: D611-LTR4-TNT-insertion-6
Description: D611-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D611-LTR4-TNT-insertion-6
D611-LTR4-TNT-insertion-6
[»] chr3 (2 HSPs)
chr3 (8-578)||(48235605-48236174)
chr3 (263-478)||(50439335-50439550)
[»] chr1 (3 HSPs)
chr1 (245-578)||(3686562-3686895)
chr1 (65-186)||(3686383-3686503)
chr1 (263-477)||(1273956-1274170)
[»] chr2 (3 HSPs)
chr2 (404-475)||(45728271-45728342)
chr2 (227-348)||(42673868-42673989)
chr2 (431-472)||(42674072-42674113)
[»] chr8 (2 HSPs)
chr8 (241-348)||(6516733-6516840)
chr8 (428-468)||(6516920-6516960)
[»] scaffold0229 (1 HSPs)
scaffold0229 (355-477)||(56-178)


Alignment Details
Target: chr3 (Bit Score: 555; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 555; E-Value: 0
Query Start/End: Original strand, 8 - 578
Target Start/End: Complemental strand, 48236174 - 48235605
Alignment:
8 atgacaagaatatgtttacacaattatgacaatatactttttcctccttacgtgcacaggttgaggtactaagcagtattagacatccaaatatggtcct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
48236174 atgacaagaatatgtttacacaattatgacaatatactttttcctccttacatgcacaggttgaggtactaagcagtattagacatccaaatatggtcct 48236075  T
108 cctccttggagcatgtcctgagcattgttgtttggtgtatgagtggcatggaaaacggtaccttagaagatagattatttcggaaaaataactctaagcc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48236074 cctccttggagcatgtcctgagcattgttgtttggtgtatgagta-catggaaaacggtaccttagaagatagattatttcggaaaaataactctaagcc 48235976  T
208 tctatcatggcaaaaaaggttcaaaatagcagctgagattgcaactgcacttcttttccttcaccaaacaaagccagagccaatcgtgcatcgagacctt 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48235975 tctatcatggcaaaaaaggttcaaaatagcagctgagattgcaactgcacttcttttccttcaccaaacaaagccagagccaatcgtgcatcgagacctt 48235876  T
308 aaaccatcaaacattttgttagacaaaaattacgtgagcaaagtcgctgatgtcggtctcgcaagattagttcctccttctgtagctgacagcgtgacac 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48235875 aaaccatcaaacattttgttagacaaaaattacgtgagcaaagtcgctgatgtcggtctcgcaagattagttcctccttctgtagctgacagcgtgacac 48235776  T
408 aatattacatgacttcagctgctggaacattttgttatattgatcccgagtatcaacaaacaggaatgttaacaccaaaatcagatatatattcattagg 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48235775 aatattacatgacttcagctgctggaacattttgttatattgatcccgagtatcaacaaacaggaatgttaacaccaaaatcagatatatattcattagg 48235676  T
508 gataatgctactgcagataatcacagccaggcctcctatgggactttctcatcatgttaaaagggcaattg 578  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48235675 gataatgctactgcagataatcacagccaggcctcctatgggactttctcatcatgttaaaagggcaattg 48235605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 263 - 478
Target Start/End: Complemental strand, 50439550 - 50439335
Alignment:
263 ttccttcaccaaacaaagccagagccaatcgtgcatcgagaccttaaaccatcaaacattttgttagacaaaaattacgtgagcaaagtcgctgatgtcg 362  Q
    ||||||||||||||||| ||||| || || || ||| ||||| | ||||||  |||||| ||| |||||| ||| || ||   |||| |   |||||| |    
50439550 ttccttcaccaaacaaaaccagaacctatagtacatagagacttgaaaccaggaaacatcttgctagacagaaactatgtagccaaaattagtgatgttg 50439451  T
363 gtctcgcaagattagttcctccttctgtagctgacagcgtgacacaatattacatgacttcagctgctggaacattttgttatattgatcccgagtatca 462  Q
    || | |||||| | ||||| || ||||| || ||||| ||||| ||||||  ||||||  || | || |||||||| |||||||| ||||| ||||||||    
50439450 gtttggcaagacttgttccgccatctgtggccgacagtgtgacgcaatatcgcatgacggcaacagcaggaacattctgttatatagatcctgagtatca 50439351  T
463 acaaacaggaatgtta 478  Q
     |||||||||||||||    
50439350 gcaaacaggaatgtta 50439335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 134; Significance: 2e-69; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 245 - 578
Target Start/End: Original strand, 3686562 - 3686895
Alignment:
245 attgcaactgcacttcttttccttcaccaaacaaagccagagccaatcgtgcatcgagaccttaaaccatcaaacattttgttagacaaaaattacgtga 344  Q
    |||||||| |||||||||||||||||||||||||| |||||  |||| || ||| |||||||||||||| | |||||| | |||||||||||||  || |    
3686562 attgcaacagcacttcttttccttcaccaaacaaaaccagaagcaattgttcatagagaccttaaaccagccaacattctcttagacaaaaattttgtta 3686661  T
345 gcaaagtcgctgatgtcggtctcgcaagattagttcctccttctgtagctgacagcgtgacacaatattacatgacttcagctgctggaacattttgtta 444  Q
    ||||| |   |||||| ||| | ||||||||||| || ||||||||||||||    || ||||||||| ||||||||  ||| ||||||||||| |||||    
3686662 gcaaaataagtgatgttggtttagcaagattagtaccaccttctgtagctgattctgtcacacaatatcacatgactgaagcagctggaacattatgtta 3686761  T
445 tattgatcccgagtatcaacaaacaggaatgttaacaccaaaatcagatatatattcattagggataatgctactgcagataatcacagccaggcctcct 544  Q
     |||||||| ||||||||| | |||||||  |||||| ||||||||||||| ||||| |||||||||||| | || || || |||||||| | ||||||     
3686762 cattgatccagagtatcaaaatacaggaaaattaacaacaaaatcagatatttattctttagggataatgtttcttcaaattatcacagctaagcctcca 3686861  T
545 atgggactttctcatcatgttaaaagggcaattg 578  Q
    ||||||||||||||||||||||||||||||||||    
3686862 atgggactttctcatcatgttaaaagggcaattg 3686895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 65 - 186
Target Start/End: Original strand, 3686383 - 3686503
Alignment:
65 aggttgaggtactaagcagtattagacatccaaatatggtcctcctccttggagcatgtcctgagcattgttgtttggtgtatgagtggcatggaaaacg 164  Q
    ||||||||||| || |||  || |||||||| |||||||||||||||||||| |||||||  ||  || | |||||||| ||||| |  |||||| || |    
3686383 aggttgaggtattatgcaacataagacatcccaatatggtcctcctccttggtgcatgtcaagaatatggatgtttggtatatgaat-acatggacaatg 3686481  T
165 gtaccttagaagatagattatt 186  Q
    ||| ||||||||| ||||||||    
3686482 gtagcttagaagacagattatt 3686503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 263 - 477
Target Start/End: Original strand, 1273956 - 1274170
Alignment:
263 ttccttcaccaaacaaagccagagccaatcgtgcatcgagaccttaaaccatcaaacattttgttagacaaaaattacgtgagcaaag-tcgctgatgtc 361  Q
    ||||| ||||||||||| || |||||| | || ||| |||||||||||||| ||||||| ||| | |||   || |||||  |||||| |   ||||||     
1273956 ttcctccaccaaacaaaacctgagccactagtacatagagaccttaaaccagcaaacatcttgcttgaccgcaactacgtc-gcaaagattagtgatgtt 1274054  T
362 ggtctcgcaagattagttcctccttctgtagctgacagcgtgacacaatattacatgacttcagctgctggaacattttgttatattgatcccgagtatc 461  Q
    ||| | |||||| |||| || || || ||||| ||||  ||||||||||||   ||||| || ||||| |||||||| ||||| || ||||| ||||| |    
1274055 ggtttggcaagactagtaccgccatcagtagcagacaatgtgacacaatatcgaatgacatcggctgccggaacattctgttacatagatcctgagtacc 1274154  T
462 aacaaacaggaatgtt 477  Q
    |||| |||||||||||    
1274155 aacagacaggaatgtt 1274170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 9e-16; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 404 - 475
Target Start/End: Original strand, 45728271 - 45728342
Alignment:
404 acacaatattacatgacttcagctgctggaacattttgttatattgatcccgagtatcaacaaacaggaatg 475  Q
    ||||||| || |||||| ||||| || |||||||| ||||||||||||||||||||||| ||||||||||||    
45728271 acacaatgttgcatgacatcagcagcgggaacattctgttatattgatcccgagtatcagcaaacaggaatg 45728342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 227 - 348
Target Start/End: Original strand, 42673868 - 42673989
Alignment:
227 ttcaaaatagcagctgagattgcaactgcacttcttttccttcaccaaacaaagccagagccaatcgtgcatcgagaccttaaaccatcaaacattttgt 326  Q
    |||||||||||| | |||||||| || |  ||||||||||||||||| ||||| ||||| ||  | |||||||| || || |||||| |||||||| | |    
42673868 ttcaaaatagcatcagagattgcgacaggccttcttttccttcaccagacaaaaccagaaccggttgtgcatcgcgatctcaaaccagcaaacattctct 42673967  T
327 tagacaaaaattacgtgagcaa 348  Q
    |||||| ||| ||||| |||||    
42673968 tagacagaaactacgtaagcaa 42673989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 431 - 472
Target Start/End: Original strand, 42674072 - 42674113
Alignment:
431 ggaacattttgttatattgatcccgagtatcaacaaacagga 472  Q
    |||||||||| |||||||||||| ||||||||||||||||||    
42674072 ggaacatttttttatattgatccggagtatcaacaaacagga 42674113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 241 - 348
Target Start/End: Original strand, 6516733 - 6516840
Alignment:
241 tgagattgcaactgcacttcttttccttcaccaaacaaagccagagccaatcgtgcatcgagaccttaaaccatcaaacattttgttagacaaaaattac 340  Q
    ||||||||| ||||  |||||||||||||||||| |||||||||| ||||| || ||||| ||  | ||||||  ||||||| | ||||||||||| |||    
6516733 tgagattgccactggccttcttttccttcaccaatcaaagccagatccaatagtacatcgtgatatgaaaccaggaaacattctcttagacaaaaactac 6516832  T
341 gtgagcaa 348  Q
    || |||||    
6516833 gttagcaa 6516840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 428 - 468
Target Start/End: Original strand, 6516920 - 6516960
Alignment:
428 gctggaacattttgttatattgatcccgagtatcaacaaac 468  Q
    |||||||||||||| || |||||||| ||||||||||||||    
6516920 gctggaacattttgctacattgatcctgagtatcaacaaac 6516960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0229 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0229
Description:

Target: scaffold0229; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 355 - 477
Target Start/End: Original strand, 56 - 178
Alignment:
355 tgatgtcggtctcgcaagattagttcctccttctgtagctgacagcgtgacacaatattacatgacttcagctgctggaacattttgttatattgatccc 454  Q
    |||||| ||| | |||||| |||| || || || ||||| ||||  ||||||||||||   ||||| || ||||| |||||||| ||||| || |||||     
56 tgatgttggtttggcaagactagtaccgccatcagtagcagacaatgtgacacaatatcgaatgacatcggctgccggaacattctgttacatagatcct 155  T
455 gagtatcaacaaacaggaatgtt 477  Q
    ||||| ||||| |||||||||||    
156 gagtaccaacagacaggaatgtt 178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC