View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D611-LTR4-TNT-insertion-7 (Length: 100)

Name: D611-LTR4-TNT-insertion-7
Description: D611-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] D611-LTR4-TNT-insertion-7
[»] chr7 (1 HSPs)
chr7 (7-100)||(41612041-41612134)

Alignment Details
Target: chr7 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 41612041 - 41612134
7 aataagaagggactcccacaacaagtcctacccaaaggctagccatttcaaacccagaaaaagtcctttggctaggtgtagttggcttaagatc 100  Q
41612041 aataagaagggactcccacaacaagtcctacccaaaggctagccatttcaaacccagaaaaagtcctttggctaggtgtagttggcttaagatc 41612134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC