View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D611-LTR4-TNT-insertion-8 (Length: 424)

Name: D611-LTR4-TNT-insertion-8
Description: D611-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D611-LTR4-TNT-insertion-8
D611-LTR4-TNT-insertion-8
[»] chr4 (67 HSPs)
chr4 (8-413)||(54994848-54995253)
chr4 (232-413)||(22434182-22434363)
chr4 (232-413)||(45082785-45082966)
chr4 (226-413)||(15523232-15523419)
chr4 (227-413)||(20470872-20471058)
chr4 (227-413)||(23494804-23494990)
chr4 (232-413)||(12234690-12234871)
chr4 (232-413)||(25447250-25447431)
chr4 (232-413)||(46193408-46193589)
chr4 (228-408)||(48526547-48526727)
chr4 (217-413)||(51021157-51021352)
chr4 (227-413)||(4219920-4220106)
chr4 (223-413)||(11153140-11153330)
chr4 (228-413)||(18751598-18751783)
chr4 (232-407)||(25938038-25938213)
chr4 (232-406)||(2118296-2118470)
chr4 (246-413)||(12503453-12503620)
chr4 (232-390)||(46193790-46193947)
chr4 (232-390)||(23494446-23494603)
chr4 (232-390)||(33109687-33109844)
chr4 (225-355)||(33109883-33110013)
chr4 (227-346)||(25447664-25447783)
chr4 (232-346)||(11153575-11153689)
chr4 (227-390)||(22434563-22434723)
chr4 (227-390)||(25937668-25937830)
chr4 (227-389)||(12234327-12234488)
chr4 (232-390)||(38962204-38962361)
chr4 (232-390)||(48526199-48526355)
chr4 (232-389)||(4219560-4219716)
chr4 (228-346)||(2118723-2118841)
chr4 (232-390)||(15523619-15523776)
chr4 (217-390)||(22170322-22170493)
chr4 (227-390)||(51020795-51020957)
chr4 (227-344)||(54995498-54995614)
chr4 (232-343)||(18763951-18764062)
chr4 (227-346)||(45082430-45082548)
chr4 (232-346)||(20958288-20958401)
chr4 (232-346)||(35363028-35363143)
chr4 (225-343)||(48713777-48713895)
chr4 (228-355)||(16690935-16691062)
chr4 (247-346)||(43243708-43243807)
chr4 (232-346)||(44892576-44892690)
chr4 (225-335)||(48708291-48708401)
chr4 (232-357)||(10258304-10258429)
chr4 (236-341)||(20957196-20957301)
chr4 (282-355)||(43242323-43242396)
chr4 (226-343)||(48293591-48293708)
chr4 (247-355)||(43281210-43281317)
chr4 (297-390)||(12503821-12503913)
chr4 (232-355)||(48294961-48295085)
chr4 (232-299)||(16318251-16318318)
chr4 (232-355)||(16691491-16691613)
chr4 (232-355)||(44890520-44890643)
chr4 (317-390)||(17504061-17504133)
chr4 (167-228)||(17612560-17612621)
chr4 (229-402)||(40160465-40160636)
chr4 (167-229)||(2708097-2708159)
chr4 (290-346)||(44220805-44220861)
chr4 (170-228)||(2570704-2570762)
chr4 (178-228)||(9743816-9743866)
chr4 (297-390)||(17504345-17504437)
chr4 (175-221)||(1012520-1012566)
chr4 (328-390)||(35193406-35193467)
chr4 (175-228)||(5915039-5915092)
chr4 (372-408)||(10795693-10795729)
chr4 (284-337)||(55189583-55189636)
chr4 (226-254)||(229158-229186)
[»] chr5 (62 HSPs)
chr5 (225-413)||(5818925-5819113)
chr5 (226-413)||(19359497-19359684)
chr5 (227-413)||(8647799-8647985)
chr5 (232-413)||(14215244-14215425)
chr5 (223-413)||(18182964-18183154)
chr5 (232-413)||(8461292-8461473)
chr5 (232-413)||(2864757-2864938)
chr5 (227-413)||(24331557-24331745)
chr5 (232-413)||(164194-164374)
chr5 (232-413)||(29454743-29454924)
chr5 (223-390)||(2865140-2865306)
chr5 (232-408)||(15709335-15709510)
chr5 (225-413)||(16018948-16019136)
chr5 (223-413)||(25000450-25000640)
chr5 (218-390)||(5819314-5819485)
chr5 (227-346)||(18183397-18183516)
chr5 (232-390)||(8647441-8647598)
chr5 (232-390)||(29455127-29455284)
chr5 (227-390)||(15372258-15372420)
chr5 (227-390)||(24362221-24362383)
chr5 (232-386)||(19359139-19359292)
chr5 (226-390)||(8460927-8461090)
chr5 (232-407)||(15371874-15372052)
chr5 (227-390)||(14215628-14215790)
chr5 (227-390)||(15708969-15709130)
chr5 (227-390)||(164576-164738)
chr5 (235-413)||(24361843-24362020)
chr5 (227-390)||(14463906-14464067)
chr5 (235-413)||(24325218-24325395)
chr5 (219-355)||(7349436-7349571)
chr5 (232-346)||(4222150-4222264)
chr5 (232-390)||(16018592-16018747)
chr5 (311-391)||(14462686-14462770)
chr5 (232-355)||(7348562-7348685)
chr5 (251-390)||(25000112-25000250)
chr5 (232-346)||(4623151-4623265)
chr5 (317-408)||(10721873-10721963)
chr5 (230-355)||(6019189-6019314)
chr5 (232-390)||(24331945-24332106)
chr5 (232-357)||(6018317-6018441)
chr5 (232-346)||(4219666-4219780)
chr5 (317-408)||(27307148-27307238)
chr5 (170-228)||(22616719-22616777)
chr5 (242-355)||(4624644-4624757)
chr5 (317-407)||(28494931-28495020)
chr5 (334-390)||(27307444-27307499)
chr5 (232-390)||(41834445-41834602)
chr5 (170-228)||(12080498-12080556)
chr5 (175-228)||(33163741-33163794)
chr5 (183-228)||(41417356-41417401)
chr5 (175-215)||(25654588-25654628)
chr5 (226-390)||(28290030-28290193)
chr5 (311-346)||(13814155-13814190)
chr5 (170-217)||(27579263-27579310)
chr5 (322-408)||(16752938-16753022)
chr5 (328-390)||(28495227-28495288)
chr5 (328-390)||(32305916-32305977)
chr5 (167-228)||(10237639-10237700)
chr5 (175-228)||(29766571-29766624)
chr5 (167-228)||(33752469-33752530)
chr5 (334-390)||(14340793-14340849)
chr5 (177-221)||(36055646-36055690)
[»] chr8 (40 HSPs)
chr8 (227-413)||(19176288-19176474)
chr8 (232-413)||(13225000-13225181)
chr8 (232-413)||(9928912-9929093)
chr8 (232-413)||(41681495-41681676)
chr8 (229-413)||(12572212-12572396)
chr8 (232-405)||(31133589-31133762)
chr8 (232-413)||(44831250-44831431)
chr8 (232-413)||(11656818-11656999)
chr8 (232-413)||(33328501-33328682)
chr8 (227-413)||(33742920-33743105)
chr8 (227-388)||(34540934-34541095)
chr8 (226-389)||(41681131-41681292)
chr8 (227-390)||(19176675-19176837)
chr8 (227-390)||(12571861-12572024)
chr8 (226-390)||(31133217-31133380)
chr8 (228-346)||(33328157-33328275)
chr8 (227-355)||(11656453-11656581)
chr8 (227-384)||(4629795-4629952)
chr8 (232-355)||(9930076-9930199)
chr8 (233-390)||(13224645-13224800)
chr8 (227-390)||(44831630-44831792)
chr8 (232-338)||(9178071-9178177)
chr8 (227-337)||(11336959-11337069)
chr8 (321-413)||(9177724-9177816)
chr8 (287-390)||(33743304-33743406)
chr8 (230-390)||(4630177-4630330)
chr8 (227-355)||(10918124-10918252)
chr8 (240-341)||(8073985-8074085)
chr8 (170-228)||(18756431-18756489)
chr8 (167-228)||(28220794-28220855)
chr8 (308-355)||(43958264-43958311)
chr8 (170-228)||(3038631-3038689)
chr8 (175-228)||(23176556-23176609)
chr8 (175-228)||(34686001-34686054)
chr8 (227-390)||(5730815-5730977)
chr8 (176-228)||(7290945-7290997)
chr8 (227-390)||(35427198-35427360)
chr8 (167-228)||(4108676-4108737)
chr8 (226-262)||(9177664-9177700)
chr8 (334-390)||(18805267-18805322)
[»] chr7 (40 HSPs)
chr7 (227-413)||(19590886-19591072)
chr7 (227-413)||(38859002-38859188)
chr7 (226-413)||(32004611-32004798)
chr7 (227-413)||(37787128-37787314)
chr7 (232-413)||(19830781-19830961)
chr7 (242-407)||(29099863-29100028)
chr7 (232-413)||(35288906-35289087)
chr7 (227-406)||(2658837-2659016)
chr7 (226-413)||(34533788-34533975)
chr7 (232-407)||(4641811-4641983)
chr7 (225-390)||(19830416-19830580)
chr7 (227-408)||(23952728-23952910)
chr7 (232-390)||(19590528-19590685)
chr7 (232-390)||(37786770-37786927)
chr7 (219-390)||(34534176-34534346)
chr7 (224-355)||(35289320-35289451)
chr7 (228-390)||(4641439-4641600)
chr7 (228-390)||(29100236-29100397)
chr7 (232-390)||(38858646-38858803)
chr7 (232-390)||(32004999-32005156)
chr7 (227-390)||(2659225-2659387)
chr7 (223-341)||(4478133-4478251)
chr7 (227-345)||(38160949-38161067)
chr7 (235-390)||(23953114-23953268)
chr7 (218-355)||(28583428-28583565)
chr7 (232-355)||(28584341-28584464)
chr7 (328-413)||(4477800-4477885)
chr7 (170-228)||(22955076-22955134)
chr7 (170-228)||(49002450-49002508)
chr7 (175-228)||(7743156-7743209)
chr7 (176-228)||(8133329-8133381)
chr7 (176-228)||(40382115-40382167)
chr7 (232-390)||(9181535-9181692)
chr7 (221-293)||(787267-787340)
chr7 (167-228)||(5781741-5781802)
chr7 (176-228)||(4902546-4902598)
chr7 (170-228)||(4618519-4618577)
chr7 (224-390)||(25637584-25637749)
chr7 (317-390)||(35578986-35579058)
chr7 (317-408)||(9393823-9393913)
[»] chr6 (40 HSPs)
chr6 (227-413)||(22219714-22219900)
chr6 (230-413)||(18504920-18505103)
chr6 (226-413)||(23075489-23075676)
chr6 (227-413)||(11445348-11445534)
chr6 (227-401)||(12935155-12935329)
chr6 (231-390)||(10899941-10900100)
chr6 (219-413)||(18257498-18257692)
chr6 (232-413)||(20741462-20741646)
chr6 (232-413)||(31470318-31470499)
chr6 (227-413)||(2319670-2319855)
chr6 (232-408)||(15827641-15827818)
chr6 (232-392)||(11276593-11276753)
chr6 (226-390)||(18257134-18257297)
chr6 (227-390)||(20741098-20741260)
chr6 (232-390)||(10900315-10900472)
chr6 (232-390)||(11276967-11277124)
chr6 (232-390)||(15828026-15828183)
chr6 (232-390)||(31470701-31470858)
chr6 (230-346)||(2322646-2322762)
chr6 (226-390)||(12935542-12935705)
chr6 (227-346)||(11444985-11445104)
chr6 (227-390)||(28472635-28472796)
chr6 (227-390)||(29859824-29859985)
chr6 (232-413)||(4811618-4811798)
chr6 (232-389)||(18505305-18505461)
chr6 (219-355)||(1149851-1149987)
chr6 (232-326)||(23074002-23074096)
chr6 (232-355)||(29033437-29033560)
chr6 (222-355)||(4811365-4811498)
chr6 (226-317)||(1149462-1149553)
chr6 (228-355)||(3835145-3835272)
chr6 (232-342)||(29035069-29035179)
chr6 (227-346)||(18296143-18296262)
chr6 (322-392)||(35163570-35163639)
chr6 (175-228)||(11083924-11083977)
chr6 (175-226)||(4487825-4487876)
chr6 (170-228)||(4104242-4104300)
chr6 (175-228)||(25441713-25441766)
chr6 (342-409)||(32836114-32836180)
chr6 (297-357)||(33095782-33095842)
[»] chr3 (76 HSPs)
chr3 (232-413)||(37727291-37727472)
chr3 (232-409)||(39555581-39555758)
chr3 (227-413)||(17464489-17464675)
chr3 (232-413)||(31778656-31778837)
chr3 (217-413)||(26837348-26837544)
chr3 (226-413)||(4275725-4275912)
chr3 (227-413)||(22424812-22424998)
chr3 (227-413)||(43973801-43973987)
chr3 (227-408)||(5137347-5137528)
chr3 (232-401)||(20840934-20841103)
chr3 (232-405)||(23644834-23645007)
chr3 (232-405)||(25853237-25853410)
chr3 (232-413)||(27393664-27393845)
chr3 (227-407)||(29801783-29801963)
chr3 (223-413)||(32534953-32535143)
chr3 (232-401)||(30098136-30098305)
chr3 (218-413)||(24300546-24300740)
chr3 (228-406)||(26274566-26274744)
chr3 (228-413)||(41047060-41047243)
chr3 (225-390)||(5136976-5137140)
chr3 (225-390)||(31779037-31779201)
chr3 (232-390)||(39555962-39556119)
chr3 (229-390)||(41046700-41046860)
chr3 (227-390)||(20840558-20840720)
chr3 (235-385)||(48452995-48453144)
chr3 (227-390)||(24300941-24301103)
chr3 (223-390)||(37726923-37727089)
chr3 (223-355)||(23644456-23644588)
chr3 (232-346)||(32535386-32535505)
chr3 (232-390)||(17464876-17465034)
chr3 (227-390)||(26837741-26837902)
chr3 (227-346)||(30104480-30104599)
chr3 (232-355)||(43973444-43973567)
chr3 (233-355)||(22425232-22425354)
chr3 (229-355)||(25612396-25612522)
chr3 (232-390)||(27393962-27394119)
chr3 (232-346)||(29801359-29801473)
chr3 (227-390)||(26274952-26275113)
chr3 (232-390)||(25853612-25853769)
chr3 (223-355)||(23228427-23228558)
chr3 (232-346)||(32697128-32697242)
chr3 (227-355)||(51474753-51474881)
chr3 (232-355)||(50116828-50116951)
chr3 (232-343)||(51473431-51473542)
chr3 (226-340)||(45965935-45966049)
chr3 (218-315)||(37222030-37222127)
chr3 (226-346)||(37220554-37220674)
chr3 (235-326)||(25419150-25419242)
chr3 (232-355)||(25420560-25420683)
chr3 (263-343)||(18010176-18010256)
chr3 (170-228)||(32180515-32180573)
chr3 (175-228)||(19606683-19606736)
chr3 (334-408)||(50900637-50900710)
chr3 (175-228)||(11019704-11019757)
chr3 (175-228)||(44881016-44881069)
chr3 (334-390)||(55192222-55192277)
chr3 (231-390)||(22370598-22370757)
chr3 (223-390)||(55389599-55389765)
chr3 (323-408)||(8873784-8873868)
chr3 (317-402)||(37076048-37076133)
chr3 (170-228)||(45879251-45879309)
chr3 (317-405)||(2323466-2323553)
chr3 (175-228)||(26000758-26000811)
chr3 (317-390)||(27200078-27200150)
chr3 (230-343)||(32695704-32695817)
chr3 (322-390)||(37075781-37075848)
chr3 (292-343)||(23227319-23227370)
chr3 (175-226)||(48154456-48154507)
chr3 (232-390)||(52237203-52237360)
chr3 (328-390)||(37847206-37847267)
chr3 (178-228)||(40640403-40640453)
chr3 (170-228)||(40744203-40744261)
chr3 (328-390)||(43222488-43222550)
chr3 (218-251)||(19794384-19794417)
chr3 (175-228)||(47930436-47930489)
chr3 (232-390)||(51827960-51828117)
[»] scaffold0951 (2 HSPs)
scaffold0951 (227-413)||(2028-2214)
scaffold0951 (226-390)||(1664-1827)
[»] chr2 (57 HSPs)
chr2 (227-413)||(22374686-22374872)
chr2 (232-413)||(18450833-18451014)
chr2 (228-413)||(40027501-40027686)
chr2 (232-413)||(40815348-40815529)
chr2 (218-413)||(11090881-11091076)
chr2 (227-406)||(7446714-7446893)
chr2 (231-409)||(8425357-8425534)
chr2 (227-413)||(43058694-43058879)
chr2 (236-405)||(239721-239890)
chr2 (232-413)||(28616975-28617156)
chr2 (227-390)||(26538463-26538626)
chr2 (232-413)||(3025824-3026003)
chr2 (226-407)||(1978476-1978657)
chr2 (225-390)||(11090517-11090681)
chr2 (232-413)||(14432502-14432683)
chr2 (227-390)||(40815730-40815892)
chr2 (225-355)||(22374316-22374446)
chr2 (227-390)||(239351-239512)
chr2 (219-390)||(1978098-1978268)
chr2 (232-355)||(28616616-28616739)
chr2 (232-390)||(40027143-40027300)
chr2 (232-390)||(43058336-43058493)
chr2 (227-346)||(3025464-3025583)
chr2 (227-390)||(18451216-18451378)
chr2 (232-355)||(20444752-20444875)
chr2 (232-355)||(26538100-26538223)
chr2 (220-347)||(28847122-28847249)
chr2 (229-390)||(14432142-14432302)
chr2 (227-344)||(20440461-20440578)
chr2 (231-390)||(8425745-8425903)
chr2 (232-344)||(35781093-35781205)
chr2 (232-355)||(35779711-35779834)
chr2 (232-346)||(7446345-7446459)
chr2 (232-355)||(8972240-8972363)
chr2 (232-342)||(15551502-15551612)
chr2 (232-346)||(15552482-15552595)
chr2 (167-228)||(41713387-41713448)
chr2 (176-228)||(18947380-18947432)
chr2 (176-228)||(19073578-19073630)
chr2 (227-390)||(28143416-28143577)
chr2 (170-221)||(38249902-38249953)
chr2 (166-228)||(19093680-19093742)
chr2 (175-228)||(17244839-17244892)
chr2 (170-226)||(41644101-41644157)
chr2 (178-225)||(18779179-18779226)
chr2 (167-228)||(6178000-6178061)
chr2 (175-228)||(15651074-15651127)
chr2 (175-228)||(18059131-18059184)
chr2 (223-388)||(31797166-31797329)
chr2 (167-228)||(34441641-34441702)
chr2 (322-390)||(14942230-14942297)
chr2 (170-221)||(39788374-39788425)
chr2 (179-220)||(27138794-27138835)
chr2 (187-228)||(40912471-40912512)
chr2 (232-390)||(4355758-4355915)
chr2 (227-390)||(20128123-20128285)
chr2 (232-390)||(43216095-43216252)
[»] chr1 (49 HSPs)
chr1 (225-413)||(50970274-50970462)
chr1 (232-413)||(17433576-17433757)
chr1 (232-413)||(21856045-21856226)
chr1 (232-413)||(29869980-29870161)
chr1 (237-413)||(33143925-33144101)
chr1 (227-413)||(15646190-15646376)
chr1 (232-413)||(5539819-5540000)
chr1 (232-413)||(8678544-8678725)
chr1 (224-413)||(15173455-15173643)
chr1 (232-413)||(39154381-39154562)
chr1 (232-413)||(4636332-4636513)
chr1 (232-413)||(18984480-18984661)
chr1 (232-390)||(29307326-29307484)
chr1 (232-402)||(26859062-26859232)
chr1 (227-390)||(9019347-9019510)
chr1 (232-390)||(15646580-15646737)
chr1 (232-416)||(5962581-5962765)
chr1 (228-390)||(15173095-15173256)
chr1 (232-390)||(50970663-50970820)
chr1 (226-390)||(18984116-18984279)
chr1 (219-390)||(5540203-5540373)
chr1 (232-390)||(8678927-8679083)
chr1 (232-390)||(29306956-29307113)
chr1 (232-390)||(33144304-33144461)
chr1 (228-390)||(5962963-5963124)
chr1 (232-390)||(29869623-29869780)
chr1 (226-346)||(26859487-26859607)
chr1 (227-355)||(9018971-9019099)
chr1 (284-413)||(17112336-17112465)
chr1 (232-390)||(21856428-21856585)
chr1 (232-390)||(17433219-17433376)
chr1 (232-346)||(39154022-39154136)
chr1 (232-355)||(52268293-52268416)
chr1 (232-345)||(52269177-52269290)
chr1 (227-315)||(2733416-2733504)
chr1 (176-228)||(15964326-15964378)
chr1 (237-329)||(47827033-47827125)
chr1 (289-390)||(4636033-4636132)
chr1 (232-304)||(47826967-47827039)
chr1 (322-390)||(17088243-17088310)
chr1 (227-379)||(45048533-45048683)
chr1 (170-228)||(13876683-13876741)
chr1 (170-228)||(16135549-16135607)
chr1 (169-221)||(3120625-3120677)
chr1 (328-390)||(17088526-17088587)
chr1 (178-228)||(27118556-27118606)
chr1 (183-228)||(16127743-16127788)
chr1 (167-228)||(25943424-25943485)
chr1 (175-228)||(47554981-47555034)
[»] scaffold0417 (2 HSPs)
scaffold0417 (232-409)||(10988-11165)
scaffold0417 (248-390)||(10640-10781)
[»] scaffold0007 (3 HSPs)
scaffold0007 (228-407)||(64672-64851)
scaffold0007 (232-390)||(64305-64462)
scaffold0007 (232-390)||(205754-205910)
[»] scaffold1223 (2 HSPs)
scaffold1223 (232-390)||(1125-1283)
scaffold1223 (232-390)||(756-912)
[»] scaffold0273 (2 HSPs)
scaffold0273 (268-413)||(4242-4387)
scaffold0273 (227-390)||(4592-4754)
[»] scaffold0295 (2 HSPs)
scaffold0295 (232-408)||(5161-5333)
scaffold0295 (227-390)||(4791-4953)
[»] scaffold0157 (2 HSPs)
scaffold0157 (246-413)||(16857-17024)
scaffold0157 (297-390)||(16564-16656)
[»] scaffold0027 (2 HSPs)
scaffold0027 (228-390)||(42168-42330)
scaffold0027 (227-390)||(42544-42705)
[»] scaffold0019 (1 HSPs)
scaffold0019 (227-390)||(134058-134220)
[»] scaffold0432 (2 HSPs)
scaffold0432 (232-389)||(10259-10414)
scaffold0432 (231-413)||(9934-10114)
[»] scaffold0176 (2 HSPs)
scaffold0176 (232-326)||(19069-19163)
scaffold0176 (235-346)||(18841-18952)
[»] scaffold0113 (1 HSPs)
scaffold0113 (233-343)||(28674-28784)
[»] scaffold1585 (1 HSPs)
scaffold1585 (232-354)||(570-692)
[»] scaffold0076 (1 HSPs)
scaffold0076 (229-332)||(8451-8554)
[»] scaffold0057 (2 HSPs)
scaffold0057 (230-355)||(61877-62002)
scaffold0057 (226-303)||(61025-61102)
[»] scaffold0168 (1 HSPs)
scaffold0168 (278-355)||(7707-7784)
[»] scaffold1696 (1 HSPs)
scaffold1696 (233-345)||(454-565)
[»] scaffold0262 (1 HSPs)
scaffold0262 (176-228)||(11443-11495)
[»] scaffold0050 (1 HSPs)
scaffold0050 (175-228)||(5815-5868)
[»] scaffold0200 (1 HSPs)
scaffold0200 (167-228)||(24579-24640)


Alignment Details
Target: chr4 (Bit Score: 383; Significance: 0; HSPs: 67)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 8 - 413
Target Start/End: Original strand, 54994848 - 54995253
Alignment:
8 ataagcatctttgaagaatttgtgtgcgctaattaaaatataagtcatatgcaattttctgagtgtattcattactttttcttttcaaacatacccctta 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54994848 ataagcatctttgaagaatttgtgtgcgctaattaaaatataagtcatatgcaattttctgagtgtattcattactttttcttttcaaacatacccctta 54994947  T
108 ttaacagggtttctacagtgcggtcagaaaattaactgacttttttggtaaaattattttgttggtcgaccactctaaaactaatttttaccttattaca 207  Q
    |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||    
54994948 ttaacagggtttctacggtgcggtcagaaaactaactgacttttttggtaaaattattttgttggtcgaccactctaaaactaacttttactttattaca 54995047  T
208 aatcagtcctcatataaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacgg 307  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54995048 aatcagtcctcatacaaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacgg 54995147  T
308 tccttcaattatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacc 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
54995148 tccttcaattatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggttttagacctacc 54995247  T
408 cttatg 413  Q
    ||||||    
54995248 cttatg 54995253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 232 - 413
Target Start/End: Original strand, 22434182 - 22434363
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||     
22434182 ttaattacacttttggtcctcgtgttttggcatactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcatttttgttgt 22434281  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||| ||||    
22434282 atttttcgtcctacctcctattttcaaactccagaaacgcagagaaatgacagttttaggcggttttagacctacccctatg 22434363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 232 - 413
Target Start/End: Complemental strand, 45082966 - 45082785
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||| ||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||    
45082966 ttaattacacttttggtcctcgtgttttggcttactcacgaaactggtcatgcccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 45082867  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||| ||||||||||||| ||||    
45082866 atttttcgtcctacctcctattttcaaactctagaaacgcagagaaatgacagttttaggcggttttagacctacccctatg 45082785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 226 - 413
Target Start/End: Original strand, 15523232 - 15523419
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    ||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |||||    
15523232 ataggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattattatttt 15523331  T
326 tgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    | ||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||| |||| ||||||||||||| ||||    
15523332 ttttgcatttttcgtcctacctcctattttcaaactctagaaacgcagagaaatgacagttttatgcggttttagacctacccctatg 15523419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 227 - 413
Target Start/End: Complemental strand, 20471058 - 20470872
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| |||||||||| |||||||| ||| | |||||||||||||||||||||||||| ||||||||||||||||    
20471058 taggcttaattacacttttggtcctcgtgttttggcctacttacgaaactggtcattcccttttaaaacagaacaaaacggtcattcaattatcattttt 20470959  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||| ||||||||||||| ||||    
20470958 gttgcatttttcgtcctacctcctattttcaaactccagaaacgcagagaaatgaaagttttaggcggttttagacctacccctatg 20470872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 227 - 413
Target Start/End: Complemental strand, 23494990 - 23494804
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||    
23494990 taggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcattttt 23494891  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||| ||||||| |||||||||||||| ||| ||||||| || |||||||||| ||||||||||||| ||||    
23494890 gttgcatttttcgtcctacatcctattctcaaactccagaaacgtaaagaaatggcaattttaggcggttttagacctacccctatg 23494804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 232 - 413
Target Start/End: Complemental strand, 12234871 - 12234690
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||| ||||||||||||||||| |||||||||||||||||||  || | ||||||||||||||||||||||||||||||||||||||||||||||||    
12234871 ttaattatacttttggtcctcgtgttttggcctactcacgaaactgatcatgcccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 12234772  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| | ||||||||||||| ||||    
12234771 atttttcgtcctacctcctattttcaaaccccagaaatgcagagaaatgacagttttaggcagttttagacctacccctatg 12234690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 232 - 413
Target Start/End: Original strand, 25447250 - 25447431
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| |||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
25447250 ttaattacacttttggtcctcgtgttttggcctactcatgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 25447349  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||| ||| | |||||||||||| |||||||| | ||||||||||||| ||||    
25447350 atttttcgtcctacctcctattttcaaactccataaacgcagagaaatgacaattttaggcagttttagacctacccatatg 25447431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 232 - 413
Target Start/End: Original strand, 46193408 - 46193589
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||||||||||||||| | ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||    
46193408 ttaattacacttttggtcctcgtgttttggcctactcacgaaattggtcctgcccttttaaaacagaacaaaaaggtccttcaattatcatttttgttgc 46193507  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||| |||||| |||||| ||||    
46193508 atttttcgtcctacctcctattttcaaactccagaaacgcagagaaatgacagttttagacggttttagatctacccctatg 46193589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 228 - 408
Target Start/End: Complemental strand, 48526727 - 48526547
Alignment:
228 aggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttg 327  Q
    ||||||||||| ||||||||||||||||| |||| |||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||| |||||    
48526727 aggtttaattatacttttggtcctcgtgttttggtctactcacgaaactggtcttgcccttttaaaacagaacaaaacggtccttcaattatcacttttg 48526628  T
328 ttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctaccc 408  Q
    ||||||||||||||||||||||||||||||||||||| |||   ||||||||||||||||||||||| |||||||||||||    
48526627 ttgcatttttcgtcctacctcctattttcaaactccataaacacagagaaatgacagttttaggcggttttagacctaccc 48526547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 217 - 413
Target Start/End: Complemental strand, 51021352 - 51021157
Alignment:
217 tcatataaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaat 316  Q
    ||||| |||||||| ||||||||||||||| ||||||||| ||||||||||||||||| | ||||| ||||||||||||| ||||||||||||||| |||    
51021352 tcataaaaaataggcttaattacacttttgatcctcgtgttttggcctactcacgaaattggtcctgcccttttaaaacacaacaaaacggtcctttaat 51021253  T
317 tatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| || |||||||||| ||||||||||||| ||||    
51021252 tatca-ttttgttgcatttttcgtcctacctcctattttcaaactccagaaacgcagagaaatggcaattttaggcggttttagacctacccctatg 51021157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 227 - 413
Target Start/End: Complemental strand, 4220106 - 4219920
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||  |||| | ||||||||||||||||||| |||| ||||||||||||||||    
4220106 taggtttaattacacttttggtcctcgtgttttggcctactcacgaaactgatcctgctcttttaaaacagaacaaaatggtcattcaattatcattttt 4220007  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||||| || ||| | |||||||| |||||||||||||| |||||||| |||| ||||    
4220006 gttgcatttttcgtcctacctcctattttcaaacttcaaaaacgcagagaaataacagttttaggcggttttagacccacccctatg 4219920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 223 - 413
Target Start/End: Original strand, 11153140 - 11153330
Alignment:
223 aaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcat 322  Q
    |||| ||| ||||||| ||||||||||||||||| ||||||||||||| ||| | ||| | ||||||||||| |||| ||||||||||||||||||||||    
11153140 aaaaaaggcttaattatacttttggtcctcgtgttttggcctactcacaaaattggtcatgcccttttaaaatagaataaaacggtccttcaattatcat 11153239  T
323 ttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||| ||||||||||||| ||||    
11153240 ttttgttgcatttttcgtcctacctcctattttcaaaccccagaaacgcagagaaatgacagttttaggcggttttagacctacccctatg 11153330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 228 - 413
Target Start/End: Original strand, 18751598 - 18751783
Alignment:
228 aggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttg 327  Q
    ||||||||||||||||||||||||||||| ||||||||||||  ||||| ||| | |||||||||||||||||||||||||||||||| |||||||||||    
18751598 aggtttaattacacttttggtcctcgtgttttggcctactcataaaactggtcatgcccttttaaaacagaacaaaacggtccttcaaatatcatttttg 18751697  T
328 ttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||| ||||||||||||||||||||||||| | ||| ||||| ||||||||||||| ||||||| ||||| ||||    
18751698 ttgcatttttcgtcccacctcctattttcaaactccagaaacgcagaaaaatggcagttttaggcggttttagacttacccctatg 18751783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 232 - 407
Target Start/End: Complemental strand, 25938213 - 25938038
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||||||||| |||| ||||||||||||||||| | ||||| |||||||||||||||||||||| |||||||||||||||||||||||||    
25938213 ttaattacacttttggtccttgtgttttggcctactcacgaaattggtcctgcccttttaaaacagaacaaaacagtccttcaattatcatttttgttgc 25938114  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacc 407  Q
    |||||| ||||||||||||||||||||||||||||||   | ||||||| |||||||| |||| ||||||||||||    
25938113 attttttgtcctacctcctattttcaaactccagaaacacaaagaaatggcagttttatgcggttttagacctacc 25938038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 232 - 406
Target Start/End: Original strand, 2118296 - 2118470
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||||||||| |||| ||||||||||||||||| | ||||| ||||||||||||| |||||||  |||||||||||||||||||||||||    
2118296 ttaattacacttttggtccttgtgttttggcctactcacgaaattggtcctgcccttttaaaacataacaaaatagtccttcaattatcatttttgttgc 2118395  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctac 406  Q
    |||||||||||||||||||||||||||||| |||||| | ||||||||  ||||||||||||| |||||||||||    
2118396 atttttcgtcctacctcctattttcaaacttcagaaacgcagagaaattgcagttttaggcggttttagacctac 2118470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 246 - 413
Target Start/End: Original strand, 12503453 - 12503620
Alignment:
246 ggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatttttcgtcctac 345  Q
    ||||||||||| ||| | |||||||||||||  |||  || ||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||    
12503453 ggtcctcgtgttttgacttactcacgaaactgatcccgccattttaaaacagaacaaaattgtccttcaattatcatttttgttgcatttttcgtcctac 12503552  T
346 ctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||| | |||||||| |||||||||||||  ||||||||||||| ||||    
12503553 ctcctattttcaaactccagaaacgcagagaaattacagttttaggcgattttagacctacccctatg 12503620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 232 - 390
Target Start/End: Complemental strand, 46193947 - 46193790
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||| ||||    
46193947 ttaattacacttttggtcctcgtgttttggcctactcacgaaattggtcctgcccttttaaaacagaacaaaacggtccttcaattatcatttttattgc 46193848  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  ||||| ||| |||||||| ||||||||||||    
46193847 atttttcgtcctaccccccatttt-attctccaaaaacgtagagaattgacagttttag 46193790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 232 - 390
Target Start/End: Original strand, 23494446 - 23494603
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||| ||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||    
23494446 ttaattacatttttggtcctcgtgttttggcctactcacgaaactagtcctgcccttttaaaacagaacaaagcggtccttcaattatcatttttattgc 23494545  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  ||||| | | | |||||||||||||||||||    
23494546 atttttcgtcctaccccccatttt-attctccaaacacgcagagaaatgacagttttag 23494603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 232 - 390
Target Start/End: Original strand, 33109687 - 33109844
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||| ||||||||||||||| ||||| ||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||||||    
33109687 ttaattacatttttggtcctcgtgttttggcatactcacgaaactggtcctgctcttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 33109786  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
33109787 atttttcgtcctaccccccatttt-attctccaaaaacgcagagaaatgacagttttag 33109844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 225 - 355
Target Start/End: Complemental strand, 33110013 - 33109883
Alignment:
225 aataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattt 324  Q
    |||||| ||||||||||||||||||||| ||| ||||||| ||||||||| | ||||| ||||||||||||| |||||||||||||||||||||||||||    
33110013 aataggcttaattacacttttggtcctcatgttttggcctgctcacgaaattggtcctgcccttttaaaacataacaaaacggtccttcaattatcattt 33109914  T
325 ttgttgcatttttcgtcctacctcctatttt 355  Q
    |||||||||||||||||||||||||||||||    
33109913 ttgttgcatttttcgtcctacctcctatttt 33109883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 227 - 346
Target Start/End: Complemental strand, 25447783 - 25447664
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| |||||||||||||||||| |||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||    
25447783 taggcttaattacacttttggtcttcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtctttcaattatcattttt 25447684  T
327 gttgcatttttcgtcctacc 346  Q
    ||||||||||||||||||||    
25447683 gttgcatttttcgtcctacc 25447664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 232 - 346
Target Start/End: Complemental strand, 11153689 - 11153575
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| ||||| || |||||||||||||||||||| ||||||||||||||||||||||||    
11153689 ttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgccattttaaaacagaacaaaacgttccttcaattatcatttttgttgc 11153590  T
332 atttttcgtcctacc 346  Q
    |||||||||||||||    
11153589 atttttcgtcctacc 11153575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 227 - 390
Target Start/End: Complemental strand, 22434723 - 22434563
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| || ||||||| ||||||||||||||| ||||||||||||||||    
22434723 taggtttaattacatttttggtcctcgtgttttggcctactcacgaaactggtcctgccattttaaa-cagaacaaaacggtcattcaattatcattttt 22434625  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
22434624 gttgcatttttcgtcctacc-cccatttt-attctccaaaaacgcagagaaatgacagttttag 22434563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 227 - 390
Target Start/End: Original strand, 25937668 - 25937830
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||| ||||||||||||||| || |||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||    
25937668 taggcttaattacatttttggtcctcgtgttttagcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcattttt 25937767  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||| |||||  | || ||||| |  ||||| ||| | |||||||||||||||||||    
25937768 gttgcattttttgtcctgtcccccatttt-attctccaaaaacgcagagaaatgacagttttag 25937830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 227 - 389
Target Start/End: Original strand, 12234327 - 12234488
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||| ||| ||||| || |||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||    
12234327 taggcttaattacacttttggtcctcttgttttggcttattcacgaaactggtcctgcccttttaaaacagaacaaaacggtcattcaattatcattttt 12234426  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagtttta 389  Q
    |||||||||||||||||||| || ||||| |  ||||| ||| | |||||||| |||||||||    
12234427 gttgcatttttcgtcctaccccccatttt-attctccaaaaacgcagagaaataacagtttta 12234488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 232 - 390
Target Start/End: Complemental strand, 38962361 - 38962204
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||| ||||||||||||||| |||| ||| |||||||||| ||||  ||||||||||||||||||||||||||||||||||||||||||||||||    
38962361 ttaattacatttttggtcctcgtgttttggtctattcacgaaactggtccggcccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 38962262  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  || || ||| | |||||||||||||||||||    
38962261 atttttcgtcctaccccccatttt-attcttcaaaaacgcagagaaatgacagttttag 38962204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 232 - 390
Target Start/End: Original strand, 48526199 - 48526355
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||| ||||||| ||| |||||||| |||||| |  || ||||||||||||||||||||||||||||||||||||||||||||||||    
48526199 ttaattacacttttggttctcgtgttttgacctactcatgaaactggctctgcccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 48526298  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  ||||| ||||| |||||||||||||||||||    
48526299 atttttcgtcctacc-cccatttt-attctccaaaaatgcagagaaatgacagttttag 48526355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 232 - 389
Target Start/End: Original strand, 4219560 - 4219716
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||| ||||||||||||||| ||||||||||||||||||| ||||| || |||||||| | |||||||| |||||||||||||||||||||||||    
4219560 ttaattacatttttggtcctcgtgttttggcctactcacgaaactggtcctgccattttaaaataaaacaaaacagtccttcaattatcatttttgttgc 4219659  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagtttta 389  Q
    ||||||||||||||| || ||||| |  ||||| ||| | ||||||||||||||||||    
4219660 atttttcgtcctaccccccatttt-attctccaaaaacgcagagaaatgacagtttta 4219716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 228 - 346
Target Start/End: Complemental strand, 2118841 - 2118723
Alignment:
228 aggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttg 327  Q
    |||||||||||||||||||||| |||||| ||||||| |||| |||||| |||||| |||||||||||| |||||||||||| |||||||||||||||||    
2118841 aggtttaattacacttttggtcttcgtgttttggcctgctcatgaaactggtcctatccttttaaaacataacaaaacggtcattcaattatcatttttg 2118742  T
328 ttgcatttttcgtcctacc 346  Q
    |||||||||||||||||||    
2118741 ttgcatttttcgtcctacc 2118723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 232 - 390
Target Start/End: Complemental strand, 15523776 - 15523619
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||||||| |||||| |||| |||||||||||||| ||||| ||||||||||||| ||||||| |||||||||| |||||||||||||||    
15523776 ttaattacacttttggtcatcgtgttttgggctactcacgaaactggtcctgcccttttaaaacaaaacaaaatggtccttcaagtatcatttttgttgc 15523677  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  ||||| ||| | | |||||||||||||||||    
15523676 atttttcgtcctaccccccatttt-attctccaaaaacgcaaagaaatgacagttttag 15523619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 217 - 390
Target Start/End: Complemental strand, 22170493 - 22170322
Alignment:
217 tcatataaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaat 316  Q
    |||||| ||| ||| ||||||||||||||||||||||||| ||| |||||| |||||| | ||||| || |||||||||| |||||||||||| ||||||    
22170493 tcatattaaaaaggcttaattacacttttggtcctcgtgttttgacctactgacgaaatt-gtcctgcctttttaaaacaaaacaaaacggtcattcaat 22170395  T
317 tatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
22170394 tatcatttttgttgcatttttcgtcctaccccccatttt-attctccaaaaacgcagagaaatgacagttttag 22170322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 227 - 390
Target Start/End: Original strand, 51020795 - 51020957
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||| ||||| ||| |||||  | |||| ||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||    
51020795 taggcttaattacacttttgatcctcatgttttggctaattcactaaactggtcctgcccttttaaaacagaacaaaacgatccttcaattatcattttt 51020894  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||||||| || ||||| |  || || ||| |||||||||||||||||||||    
51020895 gttgcatttttcgtcctaccccccatttt-attcttcaaaaacgtagagaaatgacagttttag 51020957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 227 - 344
Target Start/End: Complemental strand, 54995614 - 54995498
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||  || | ||||||||||| |||||||||||||||||||| ||||| ||||    
54995614 taggtttaattacacttttggtcctcgtgttttggcctactcacgaaactgatcatgcccttttaaaatagaacaaaacggtccttcaagtatca-tttt 54995516  T
327 gttgcatttttcgtccta 344  Q
    ||||||||||||||||||    
54995515 gttgcatttttcgtccta 54995498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 232 - 343
Target Start/End: Complemental strand, 18764062 - 18763951
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| ||| |  |||||||||||||||||||| |||| ||||| |||||||||||||||    
18764062 ttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcatgtccttttaaaacagaacaaaatggtcattcaagtatcatttttgttgc 18763963  T
332 atttttcgtcct 343  Q
    ||||||||||||    
18763962 atttttcgtcct 18763951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 227 - 346
Target Start/End: Original strand, 45082430 - 45082548
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    ||||||||||||| ||||||||| |||||| |||| ||||||||||| || ||  | ||||||||||| |||||||||||||||||||||||||||||||    
45082430 taggtttaattacgcttttggtcatcgtgttttggtctactcacgaa-ctggttttgcccttttaaaatagaacaaaacggtccttcaattatcattttt 45082528  T
327 gttgcatttttcgtcctacc 346  Q
    ||||||||||||||||||||    
45082529 gttgcatttttcgtcctacc 45082548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 232 - 346
Target Start/End: Complemental strand, 20958401 - 20958288
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||| |||||||| | ||||||||||||||||| | ||||| ||||||||||||||||||||   |||||||||||||||||||||||||    
20958401 ttaattacacttttagtcctcgtattttggcctactcacgaaaatggtcctgcccttttaaaacagaacaaatatgtccttcaattatcatttttgttgc 20958302  T
332 atttttcgtcctacc 346  Q
    |||||| ||||||||    
20958301 attttt-gtcctacc 20958288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 232 - 346
Target Start/End: Complemental strand, 35363143 - 35363028
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaa-caaaacggtccttcaattatcatttttgttg 330  Q
    ||||||||||||||| ||||||||| ||||||||||||||||||| || || | ||||||||| | || |||||||||| ||||||||||||||||||||    
35363143 ttaattacacttttgatcctcgtgttttggcctactcacgaaactggttctgctcttttaaaaaaaaaacaaaacggtcattcaattatcatttttgttg 35363044  T
331 catttttcgtcctacc 346  Q
    |||||||||| |||||    
35363043 catttttcgttctacc 35363028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 225 - 343
Target Start/End: Complemental strand, 48713895 - 48713777
Alignment:
225 aataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattt 324  Q
    |||||||||||||||||||||  | ||||||| || ||||||||| |||| | ||| | | |||||||||||||||||||  ||||||||||||||||||    
48713895 aataggtttaattacacttttaattctcgtgttttagcctactcatgaaaatggtcatgctcttttaaaacagaacaaaattgtccttcaattatcattt 48713796  T
325 ttgttgcatttttcgtcct 343  Q
    |||||||||||||||||||    
48713795 ttgttgcatttttcgtcct 48713777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 228 - 355
Target Start/End: Original strand, 16690935 - 16691062
Alignment:
228 aggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttg 327  Q
    ||||||||||||| |||||||||| |||| |||  |||||||||||| | ||||| ||  ||||||||| |||||||   ||||||||||||||||||||    
16690935 aggtttaattacatttttggtccttgtgttttgatctactcacgaaaatggtcctgcctctttaaaacaaaacaaaattatccttcaattatcatttttg 16691034  T
328 ttgcatttttcgtcctacctcctatttt 355  Q
    ||||||||||||||||||| || |||||    
16691035 ttgcatttttcgtcctacccccgatttt 16691062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 247 - 346
Target Start/End: Complemental strand, 43243807 - 43243708
Alignment:
247 gtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatttttcgtcctacc 346  Q
    |||||||||| ||||||||||||||||| | ||| | |||||||||||||||||||||  || |||||||||||||||||||||||||||| ||||||||    
43243807 gtcctcgtgttttggcctactcacgaaaatggtcatgcccttttaaaacagaacaaaattgttcttcaattatcatttttgttgcattttttgtcctacc 43243708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 232 - 346
Target Start/End: Complemental strand, 44892690 - 44892576
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||| | ||||||||||||||| ||| ||||||||||||| | || || || ||||||||||||||||||| ||| |||||||||  ||||||||||    
44892690 ttaattatatttttggtcctcgtgttttgacctactcacgaaaatggttctgccattttaaaacagaacaaaactgtctttcaattatattttttgttgc 44892591  T
332 atttttcgtcctacc 346  Q
    |||||||||||||||    
44892590 atttttcgtcctacc 44892576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 225 - 335
Target Start/End: Original strand, 48708291 - 48708401
Alignment:
225 aataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattt 324  Q
    |||||| |||||||||||||||||||  |||| ||||||||  ||||||| |  |||| ||||||||||||| |||||||| ||||||||||||||||||    
48708291 aataggcttaattacacttttggtccatgtgttttggcctaaccacgaaaatgatcctgcccttttaaaacacaacaaaactgtccttcaattatcattt 48708390  T
325 ttgttgcattt 335  Q
    |||||||||||    
48708391 ttgttgcattt 48708401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 232 - 357
Target Start/End: Complemental strand, 10258429 - 10258304
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||||||||||||||  ||||||||||| |||| | ||||| |||||||||||||||  ||||  ||  |||||||||||||||||||||    
10258429 ttaattacacttttggtcctcgtgttgtggcctactcaggaaattggtcctgcccttttaaaacagattaaaattgtttttcaattatcatttttgttgc 10258330  T
332 atttttcgtcctacctcctattttca 357  Q
    | |||| ||| |||| ||||||||||    
10258329 agttttagtcttaccccctattttca 10258304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 236 - 341
Target Start/End: Original strand, 20957196 - 20957301
Alignment:
236 ttacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcattt 335  Q
    ||||| |||||||||||| || ||||| ||||||||||| | ||| ||| ||||||||||| |||||||  ||||||||||||||| |||||||||||||    
20957196 ttacatttttggtcctcgagttttggcttactcacgaaaatggtcatactcttttaaaacacaacaaaattgtccttcaattatcaattttgttgcattt 20957295  T
336 ttcgtc 341  Q
    ||||||    
20957296 ttcgtc 20957301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 282 - 355
Target Start/End: Original strand, 43242323 - 43242396
Alignment:
282 tacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatttttcgtcctacctcctatttt 355  Q
    |||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||    
43242323 tacctttttaaaacagaacaaaacggtcattcaattatcattttttttgcatttttcgtcctacctccaatttt 43242396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 226 - 343
Target Start/End: Original strand, 48293591 - 48293708
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    ||||| ||||||||||||||||||||||||| ||||| ||||||||||| |  ||||  |  ||||||||| |||||||  || ||||||||||||||||    
48293591 ataggcttaattacacttttggtcctcgtgttttggcttactcacgaaattgatcctgtctctttaaaacaaaacaaaattgttcttcaattatcatttt 48293690  T
326 tgttgcatttttcgtcct 343  Q
    ||||||||||||| ||||    
48293691 tgttgcatttttcatcct 48293708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 247 - 355
Target Start/End: Complemental strand, 43281317 - 43281210
Alignment:
247 gtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatttttcgtcctacc 346  Q
    |||||||||| ||||||||||||||||| | ||| | || ||||||||||||||||||  || |||||||||| ||||||||||||||||||||||||||    
43281317 gtcctcgtgttttggcctactcacgaaaatggtcatgccattttaaaacagaacaaaaatgttcttcaattat-atttttgttgcatttttcgtcctacc 43281219  T
347 tcctatttt 355  Q
     || |||||    
43281218 ccccatttt 43281210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 297 - 390
Target Start/End: Complemental strand, 12503913 - 12503821
Alignment:
297 gaacaaaacggtccttcaattatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||||||| ||||||||||||||||||||||||| |||| || ||||| |  ||||| ||| | |||||||||||||||||||    
12503913 gaacaaaacggtccttcaagtatcatttttgttgcatttttcgtcataccccccatttt-attctccaaaaacgcagagaaatgacagttttag 12503821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 232 - 355
Target Start/End: Complemental strand, 48295085 - 48294961
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||| |||||||| |||||| |||  |||||||||||| | ||| | ||  ||||||||| |||||||  ||| |||||||||||||||||||||    
48295085 ttaattacatttttggtcatcgtgttttgatctactcacgaaattggtcttgcctctttaaaacacaacaaaattgtcattcaattatcatttttgttgc 48294986  T
332 attttt-cgtcctacctcctatttt 355  Q
    |||||| ||||||||| || |||||    
48294985 atttttccgtcctaccccccatttt 48294961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 232 - 299
Target Start/End: Complemental strand, 16318318 - 16318251
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaa 299  Q
    ||||||||||||||||||||||||| ||||||||||||| |||||  |||| ||||||||||||||||    
16318318 ttaattacacttttggtcctcgtgttttggcctactcacaaaactgatcctgcccttttaaaacagaa 16318251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 232 - 355
Target Start/End: Complemental strand, 16691613 - 16691491
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||| |||  |||| ||| ||||||||||||| | ||||| ||  |||||| || |||||||  |||||| |||||| |||||||||||    
16691613 ttaattacacttttgatccctgtgttttgacctactcacgaaaatggtcctgcctctttaaa-cataacaaaattgtcctttaattattatttttgttgc 16691515  T
332 atttttcgtcctacctcctatttt 355  Q
    |||||||||| ||||||| |||||    
16691514 atttttcgtcatacctcccatttt 16691491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 232 - 355
Target Start/End: Original strand, 44890520 - 44890643
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||| |||||||||| |||| ||| |||| |||||||| | ||| | |||||||||||||||||||||   ||||| ||||||  ||||||||||    
44890520 ttaattacaattttggtccttgtgttttgacctattcacgaaaatggtcatgcccttttaaaacagaacaaaaatatcctttaattatattttttgttgc 44890619  T
332 atttttcgtcctacctcctatttt 355  Q
    ||||||| || |||| || |||||    
44890620 atttttcatcataccccccatttt 44890643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 317 - 390
Target Start/End: Original strand, 17504061 - 17504133
Alignment:
317 tatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||| ||| ||||| |||| |||||||||||||||||||| ||||||||| |||||||||||||||||||||    
17504061 tatcatgttttttgcagttttagtcctacctcctattttcaa-ctccagaaacgtagagaaatgacagttttag 17504133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 167 - 228
Target Start/End: Complemental strand, 17612621 - 17612560
Alignment:
167 tgttggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||| ||||||||||||||||| |||||||||||||||||| |||||||||| ||||||    
17612621 tgttggtggaccactctaaaactaaattttaccttattacaaattagtcctcatagaaaata 17612560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 229 - 402
Target Start/End: Complemental strand, 40160636 - 40160465
Alignment:
229 ggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgt 328  Q
    |||||||||||| |||||||||| |  | ||| || |||||||||| ||||| | ||  ||| |||  ||||||||| |||||  || |||||| ||| |    
40160636 ggtttaattacatttttggtccttgcattttgaccaactcacgaaaatagtcatgcctctttcaaattgaacaaaaccgtccta-aactatcatgttttt 40160538  T
329 tgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagac 402  Q
    |||| |||| ||| |||||||||||||||| ||||||||| |||||||||   ||||||||||| | |||||||    
40160537 tgcagttttagtcttacctcctattttcaa-ctccagaaacgtagagaaaatgcagttttaggcagttttagac 40160465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 167 - 229
Target Start/End: Complemental strand, 2708159 - 2708097
Alignment:
167 tgttggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaatag 229  Q
    ||||||| |||||||||||||||||  |||| ||||||||||||||| ||||||| |||||||    
2708159 tgttggtggaccactctaaaactaagctttatcttattacaaatcagccctcatacaaaatag 2708097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 290 - 346
Target Start/End: Complemental strand, 44220861 - 44220805
Alignment:
290 taaaacagaacaaaacggtccttcaattatcatttttgttgcatttttcgtcctacc 346  Q
    |||||||||||||||  |||||||| |||||||||||||| |||||||||| |||||    
44220861 taaaacagaacaaaattgtccttcatttatcatttttgtttcatttttcgttctacc 44220805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 228
Target Start/End: Complemental strand, 2570762 - 2570704
Alignment:
170 tggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    |||| |||||||||||||||||  ||||||||||||||||||| |||||| | ||||||    
2570762 tggtggaccactctaaaactaaactttaccttattacaaatcattcctcaaacaaaata 2570704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 178 - 228
Target Start/End: Complemental strand, 9743866 - 9743816
Alignment:
178 cactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    |||||||||||||| |||||| |||||||||| ||||||||||| ||||||    
9743866 cactctaaaactaaattttacattattacaaaccagtcctcatacaaaata 9743816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 297 - 390
Target Start/End: Complemental strand, 17504437 - 17504345
Alignment:
297 gaacaaaacggtccttcaattatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||| |||||| || ||| || ||| ||||| |||| || ||||||||||||||  ||||| ||||| | |||||||||||||||||||    
17504437 gaacaaaaccgtccttaaactat-atgttttttgcaattttagtactacctcctatttttcaactctagaaacgcagagaaatgacagttttag 17504345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 1012566 - 1012520
Alignment:
175 gaccactctaaaactaatttttaccttattacaaatcagtcctcata 221  Q
    ||||| ||||||||||| |||||||||||||||||||| || |||||    
1012566 gaccattctaaaactaaattttaccttattacaaatcaatcttcata 1012520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 390
Target Start/End: Original strand, 35193406 - 35193467
Alignment:
328 ttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||| |||| |||||| ||||||||||||| || |||||| | |||||||||||||||||||    
35193406 ttgcagttttagtcctatctcctattttcaa-cttcagaaacgcagagaaatgacagttttag 35193467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 175 - 228
Target Start/End: Original strand, 5915039 - 5915092
Alignment:
175 gaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||| ||| ||||| |||||| ||||||||||| |||||||||| ||||||    
5915039 gaccactgtaacactaaattttactttattacaaattagtcctcataaaaaata 5915092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 372 - 408
Target Start/End: Complemental strand, 10795729 - 10795693
Alignment:
372 agagaaatgacagttttaggcggntttagacctaccc 408  Q
    ||||||||||||||||||||| | |||||||||||||    
10795729 agagaaatgacagttttaggcagttttagacctaccc 10795693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 337
Target Start/End: Original strand, 55189583 - 55189636
Alignment:
284 cccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcattttt 337  Q
    ||||||||||| |||||||||  ||| ||||||||||||||||| | |||||||    
55189583 cccttttaaaatagaacaaaattgtctttcaattatcatttttgctacattttt 55189636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 226 - 254
Target Start/End: Original strand, 229158 - 229186
Alignment:
226 ataggtttaattacacttttggtcctcgt 254  Q
    |||||||||||||||||||||||||||||    
229158 ataggtttaattacacttttggtcctcgt 229186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 154; Significance: 1e-81; HSPs: 62)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 225 - 413
Target Start/End: Original strand, 5818925 - 5819113
Alignment:
225 aataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattt 324  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||    
5818925 aataggtttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtctttcaattatcattt 5819024  T
325 ttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||| ||||    
5819025 ttgttgcatttttcgtcttacctcctattttcaaactccagaaacgcagagaaatgacagttttaggcggttttagacctacccctatg 5819113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 226 - 413
Target Start/End: Complemental strand, 19359684 - 19359497
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    ||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||    
19359684 ataggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcatttt 19359585  T
326 tgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||| ||||    
19359584 tgttggatttttcgtcctacctcctattttcaaactccagaaacgtagagaaatggcagttttaggcggttttagacctacccctatg 19359497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 227 - 413
Target Start/End: Complemental strand, 8647985 - 8647799
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| |||||||||||||||||||  |||| |||||||||||||||||||||||||||||||||||||||||||    
8647985 taggcttaattacacttttggtcctcgtgttttggcctactcacgaaactgatcctgcccttttaaaacagaacaaaacggtccttcaattatcattttt 8647886  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||| ||||| |||||||||||||||| ||| | ||||||||||||||||||||||| ||||||||||||| ||||    
8647885 gttgcatttttcgtcataccttctattttcaaactccataaacgcagagaaatgacagttttaggcggttttagacctacccctatg 8647799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 232 - 413
Target Start/End: Original strand, 14215244 - 14215425
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||| ||||||||||||| ||  ||||||||||||||||||||||| ||||||||| ||||||||||||||||    
14215244 ttaattacacttttggtcctcgtgttttggcttactcacgaaactggttatacccttttaaaacagaacaaaaaggtccttcagttatcatttttgttgc 14215343  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||| ||||    
14215344 atttttcgtcctacctcctattttcaaactccagaaacgcagagaaatgacagttttaggcggttttagacctacccctatg 14215425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 223 - 413
Target Start/End: Original strand, 18182964 - 18183154
Alignment:
223 aaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcat 322  Q
    ||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||    
18182964 aaaataggtttaattacacttttggtcatcgtgttttggcctactcacgaaactggtcatgcccttttaaaacagaacaaaacggtccttcaattatcat 18183063  T
323 ttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||| | || ||||||| | ||||||||||||||||||||| | ||||| ||||||| ||||    
18183064 ttttgttgcatttttcgtcctacctcctatttttataccccagaaacgcagagaaatgacagttttaggcagttttaggcctacccctatg 18183154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 232 - 413
Target Start/End: Complemental strand, 8461473 - 8461292
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| |||||||||||||||||||  |||| | |||||||||||||||||||||||||||||||||||||||||| |||    
8461473 ttaattacacttttggtcctcgtgttttggcctactcacgaaactgttcctgctcttttaaaacagaacaaaacggtccttcaattatcatttttgctgc 8461374  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||| |||||||||||||||||||||||||| | |||||||||||| |||||||||| ||||||||||||| ||||    
8461373 atttttcgtcatacctcctattttcaaactccagaaacgcagagaaatgacaattttaggcggttttagacctacccctatg 8461292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 232 - 413
Target Start/End: Original strand, 2864757 - 2864938
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||||||||| |||| ||||||||||||||||| |  || | ||||||||||||| ||||||||||||||||||||||||||||||||||    
2864757 ttaattacacttttggtccttgtgttttggcctactcacgaaattgatcatgcccttttaaaacataacaaaacggtccttcaattatcatttttgttgc 2864856  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||| |||||| |||||| ||||    
2864857 atttttcgtcctacctcctattttcaaactccataaacgcagagaaatgacagttttaggcggttttagaactacccctatg 2864938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 227 - 413
Target Start/End: Original strand, 24331557 - 24331745
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatc--attt 324  Q
    |||| ||||||||||||||||||||||||| |||  |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||   |||    
24331557 taggcttaattacacttttggtcctcgtgttttgatctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatctatttt 24331656  T
325 ttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||| ||||| ||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||| ||||    
24331657 ttgttgcatttttcatcctagctcctattttcaaactccagaaacgcagagaaatgacagttttaggcggttttagacctacccctatg 24331745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 232 - 413
Target Start/End: Original strand, 164194 - 164374
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||| ||||||||||||||| ||||| |||||||| |||| |||||||||||| ||||||||||||||| |||||    
164194 ttaattacacttttggtcctcgtgttttgacctactcacgaaactggtcctgcccttttataacaaaacaaaacggtcattcaattatcatttt-gttgc 164292  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||| |||| ||||||||||||| ||||    
164293 atttttcgtcctacctcctattttcaaactccagaaacgcagagaaatgacaattttatgcggttttagacctacccctatg 164374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 232 - 413
Target Start/End: Original strand, 29454743 - 29454924
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||| ||||||||||| | |||| ||||||||||||||||| | ||| | ||||||||||||||||||||||||||||| |||||||||||||| |||    
29454743 ttaatttcacttttggtcattgtgttttggcctactcacgaaattggtcatgcccttttaaaacagaacaaaacggtccttgaattatcatttttgctgc 29454842  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||| ||||||||||||| ||||    
29454843 atttttcgtcctacctcctattttcaaactccagaaacgcagagaaatgatagttttaggcggttttagacctacccatatg 29454924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 223 - 390
Target Start/End: Complemental strand, 2865306 - 2865140
Alignment:
223 aaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcat 322  Q
    |||||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||    
2865306 aaaataggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcat 2865207  T
323 ttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||| |||||||||||||||| || ||||| |  ||||| ||| |||||||||||||||||||||    
2865206 ttttgtttcatttttcgtcctaccccccatttt-attctccaaaaacgtagagaaatgacagttttag 2865140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 232 - 408
Target Start/End: Complemental strand, 15709510 - 15709335
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||||||| | |||| |||||||||||| |||||||||| | |||||| |||||||||||||||||||||| | ||||||||| ||||||    
15709510 ttaattacacttttggtcattgtgttttggcctactcatgaaactagtcatgcccttt-aaaacagaacaaaacggtcctttagttatcatttctgttgc 15709412  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctaccc 408  Q
    ||||||||||||||||||||||||||||||||| ||  | ||||||||||||||||||||||| |||||||||||||    
15709411 atttttcgtcctacctcctattttcaaactccataagcgcagagaaatgacagttttaggcggttttagacctaccc 15709335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 225 - 413
Target Start/End: Complemental strand, 16019136 - 16018948
Alignment:
225 aataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattt 324  Q
    |||||||||||||||||||||||||||| ||| ||||| ||||||||||| | ||||| | ||||||||| |||| |||| ||| |||||||||||||||    
16019136 aataggtttaattacacttttggtcctcatgttttggcatactcacgaaattggtcctgctcttttaaaatagaataaaatggttcttcaattatcattt 16019037  T
325 ttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||| |||||||||||||||||||||||| |||||||||||| | ||||||||||||||||||| ||| |||||| |||||| ||||    
16019036 ttgttgtatttttcgtcctacctcctatttttaaactccagaaacgcagagaaatgacagttttagacggttttagatctacccctatg 16018948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 223 - 413
Target Start/End: Complemental strand, 25000640 - 25000450
Alignment:
223 aaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcat 322  Q
    |||| ||| |||||||||||||||||| || ||| ||||||||||||||||| | ||| |   ||||||||||||||||||| |||| ||||||||||||    
25000640 aaaaaaggcttaattacacttttggtcttcatgttttggcctactcacgaaattggtcatgttcttttaaaacagaacaaaatggtcattcaattatcat 25000541  T
323 ttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||||||| ||||||||||||||||||||| ||| | ||||||||||||||||||| ||| |||||| |||||| ||||    
25000540 ttttgttgcatttttcgtcccacctcctattttcaaactccaaaaacgcagagaaatgacagttttagacggttttagatctacccctatg 25000450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 218 - 390
Target Start/End: Complemental strand, 5819485 - 5819314
Alignment:
218 catataaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaatt 317  Q
    ||||| |||| || ||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||    
5819485 catattaaattggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtcattcaatt 5819386  T
318 atcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||||||||||||||||| || ||||| |  ||||| ||| | | |||||||||||||||||    
5819385 atcatttttgttgcatttttcgtcctaccccccatttt-attctccaaaaacgcaaagaaatgacagttttag 5819314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 227 - 346
Target Start/End: Complemental strand, 18183516 - 18183397
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||    
18183516 taggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcattttt 18183417  T
327 gttgcatttttcgtcctacc 346  Q
    ||||||||||||||||||||    
18183416 gttgcatttttcgtcctacc 18183397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 232 - 390
Target Start/End: Original strand, 8647441 - 8647598
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| ||||| || |||||||||||||||||| ||||||||||||||||||||||||||    
8647441 ttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgccgttttaaaacagaacaaaatggtccttcaattatcatttttgttgc 8647540  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
8647541 atttttcgtcctaccccccatttt-attctccaaaaacgcagagaaatgacagttttag 8647598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 232 - 390
Target Start/End: Complemental strand, 29455284 - 29455127
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||| |||||||||||||| |||| |||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||    
29455284 ttaattacacctttggtcctcgtgttttggtctactcacgaaactggtcctgcccttttaaaacagaacaaaatggtccttcaattatcatttttgttgc 29455185  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  ||||| ||| |||||||||||||||||||||    
29455184 atttttcgtcctaccccccatttt-attctccaaaaacgtagagaaatgacagttttag 29455127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 227 - 390
Target Start/End: Complemental strand, 15372420 - 15372258
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||    
15372420 taggtttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaagtatcattttt 15372321  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||| || |||| ||| ||||| |   |||| ||| | |||||||||||||||||||    
15372320 gttgcattttttgttctacatcccatttt-attttccaaaaacgcagagaaatgacagttttag 15372258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 227 - 390
Target Start/End: Complemental strand, 24362383 - 24362221
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||| | ||||||||||||||||||| ||||| |||||||||||||||| ||||||||||||||| ||||||||||    
24362383 taggcttaattacacttttggtcctcgtattttggcctactcacgaaactggtcctgcccttttaaaacagaataaaacggtccttcaagtatcattttt 24362284  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
24362283 gttgcatttttcgtcctaccccccatttt-attctccaaaaacgcagagaaatgacagttttag 24362221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 232 - 386
Target Start/End: Original strand, 19359139 - 19359292
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||| ||| ||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||    
19359139 ttaattacacttttggtcctcttgttttggcctactcacgaaactggtcctgcccttttaaaatagaacaaaacggtccttcaattatcatttttgttgc 19359238  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagtt 386  Q
    ||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||    
19359239 atttttcgtcctaccccccatttt-attctccaaaaacgcagagaaatgacagtt 19359292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 226 - 390
Target Start/End: Original strand, 8460927 - 8461090
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    ||||| |||||| ||||||||||| |||| | ||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||    
8460927 ataggcttaattccacttttggtcatcgtattttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtcattcaattatcatttt 8461026  T
326 tgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||| |||| || ||||| |  ||||| ||||| |||||||||||||||||||    
8461027 tgttgcatttttcgtcataccccccatttt-attctccaaaaatgcagagaaatgacagttttag 8461090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 232 - 407
Target Start/End: Original strand, 15371874 - 15372052
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||| ||||||| | |||| |||||||||||  | ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||    
15371874 ttaattacacttttgatcctcgtattttggtctactcacgaat-tggtcctgcccttttaaaacagaacaaaatggtccttcaattatcatttttgttgc 15371972  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagtt----ttaggcggntttagacctacc 407  Q
    ||||||||||| ||||||||||| ||||||| ||||| | |||||||||| ||||    |||||||| ||||||||||||    
15371973 atttttcgtcccacctcctatttgcaaactctagaaacgcagagaaatgatagttttaattaggcggttttagacctacc 15372052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 227 - 390
Target Start/End: Complemental strand, 14215790 - 14215628
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||| ||||||||||||||| ||| |||||||||||||||  |||| |||||||||||||||||||||||||||||||| ||||||||||    
14215790 taggcttaattacaattttggtcctcgtgttttgacctactcacgaaactgatcctgcccttttaaaacagaacaaaacggtccttcaagtatcattttt 14215691  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || | || ||||| |  ||||| ||| |||||||||||||||||||||    
14215690 gttgcatttttcgtcttaacccccatttt-attctccaaaaacgtagagaaatgacagttttag 14215628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 227 - 390
Target Start/End: Original strand, 15708969 - 15709130
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| |||||||||||||||||||| |||| ||||||||||||||||||| ||  | |||||||||||||||||||||||||||||||||||||||||||    
15708969 taggcttaattacacttttggtcctagtgttttggcctactcacgaaactggttatgcccttttaaaacagaacaaaacggtccttcaattatcattttt 15709068  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||| |||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
15709069 gttgcatatttcgtcctacc-cccatttt-attctccaaaaacgcagagaaatgacagttttag 15709130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 227 - 390
Target Start/End: Complemental strand, 164738 - 164576
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||| | ||||| ||||| ||| |||||| |||||| ||||| ||| | |||||||||||||||||||||||||||||||||||||||||||    
164738 taggcttaattataattttgatcctcatgttttggccaactcactaaactggtcttgcccttttaaaacagaacaaaacggtccttcaattatcattttt 164639  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||| |||||||| || ||||| |  ||||| |||||||||||||||||||||||||    
164638 gttgcattttttgtcctaccccccatttt-attctccaaaaatgtagagaaatgacagttttag 164576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 235 - 413
Target Start/End: Original strand, 24361843 - 24362020
Alignment:
235 attacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatt 334  Q
    |||||||||||||||| | ||| ||||||||| |||||||||  || | ||||| ||||||||||||||| |||||||||| ||||||||||||||||||    
24361843 attacacttttggtccccatgttttggcctacccacgaaactgatcatgcccttgtaaaacagaacaaaatggtccttcaagtatcatttttgttgcatt 24361942  T
335 tttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||| || ||||| |  ||||| ||| | |||||||||| |||||||||||| ||||||||||||| ||||    
24361943 tttcgtcctaccccccatttt-attctccacaaacgcagagaaatgatagttttaggcggttttagacctacccctatg 24362020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 227 - 390
Target Start/End: Complemental strand, 14464067 - 14463906
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| |||||||||||||| |||||||||| |||||||||||||||||||| |  |  |||||||||| ||||||||||| |||||||||||||||||||    
14464067 taggcttaattacacttttagtcctcgtgttttggcctactcacgaaactaattttgtccttttaaaatagaacaaaacgatccttcaattatcattttt 14463968  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
     ||||||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
14463967 attgcatttttcgtcctacc-ccaatttt-attctccaaaaacgcagagaaatgacagttttag 14463906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 235 - 413
Target Start/End: Original strand, 24325218 - 24325395
Alignment:
235 attacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatt 334  Q
    |||||||||||||||| | ||| ||||||||| |||||||||  || | ||||| ||||||||||||||| |||||||||| |||||||||||| |||||    
24325218 attacacttttggtccccatgttttggcctacccacgaaactgatcatgcccttgtaaaacagaacaaaatggtccttcaagtatcatttttgtcgcatt 24325317  T
335 tttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||| || ||||| |  ||||| ||| | |||||||||| |||||||| ||| ||||||||||||| ||||    
24325318 tttcgtcctaccccccatttt-attctccacaaacgcagagaaatgatagttttagccggttttagacctacccctatg 24325395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 219 - 355
Target Start/End: Complemental strand, 7349571 - 7349436
Alignment:
219 atataaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaatta 318  Q
    ||||||||| || ||||||||||||||||||||||||| |||| |||||||||||| | ||||| | ||||||||||| ||||||||  ||||||| |||    
7349571 atataaaat-ggcttaattacacttttggtcctcgtgttttggtctactcacgaaattggtcctgctcttttaaaacaaaacaaaactatccttcagtta 7349473  T
319 tcatttttgttgcatttttcgtcctacctcctatttt 355  Q
    |||||||||||||| ||||| ||||||| || |||||    
7349472 tcatttttgttgcacttttcatcctaccccccatttt 7349436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 232 - 346
Target Start/End: Complemental strand, 4222264 - 4222150
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| |||| || ||||||||| | ||| | |||||||||||||||||||||  ||| |||| ||||||||||| ||||    
4222264 ttaattacacttttggtcctcgtgttttgggcttctcacgaaaatggtcatgcccttttaaaacagaacaaaattgtcattcagttatcatttttattgc 4222165  T
332 atttttcgtcctacc 346  Q
    |||||||||||||||    
4222164 atttttcgtcctacc 4222150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 232 - 390
Target Start/End: Original strand, 16018592 - 16018747
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||||||| |||||| |||||||| |||||||| |  || | ||||||||||| |||||||||||||||||||||||| |||||| ||||    
16018592 ttaattacacttttggtcttcgtgttttggcctattcacgaaattgatcatgcccttttaaaatagaacaaaacggtccttcaattat-atttttattgc 16018690  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||| ||||||||| || ||||| |  ||||| |||| |||| |||||||||||||||    
16018691 attttccgtcctacc-cccatttt-attctccaaaaatatagaaaaatgacagttttag 16018747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 391
Target Start/End: Original strand, 14462686 - 14462770
Alignment:
311 ttcaattatcatttttgttgcatttttcgtcctacctcctattttcaaactc----cagaaatgtagagaaatgacagttttagg 391  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||| ||||||||||||||||||||||    
14462686 ttcaattatcatttttgttgcatttttcgtcctacctcctattttcaaactccagacagaaacgtagagaaatgacagttttagg 14462770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 232 - 355
Target Start/End: Original strand, 7348562 - 7348685
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||| ||||||||||| ||| || | |||||||||||| | ||| | ||||||||||||||||||||||  ||||||  ||||||||||||||||    
7348562 ttaattacatttttggtcctcatgttttagtctactcacgaaattggtcgtgcccttttaaaacagaacaaaactttccttcggttatcatttttgttgc 7348661  T
332 atttttcgtcctacctcctatttt 355  Q
    | ||||||||||||| || |||||    
7348662 acttttcgtcctaccccccatttt 7348685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 251 - 390
Target Start/End: Original strand, 25000112 - 25000250
Alignment:
251 tcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatttttcgtcctacctcct 350  Q
    |||||| ||||||||||||||||  | ||| | |||| ||||||||||| |||| ||||||| ||||||||||||| |||||||||| |||||||| ||     
25000112 tcgtgttttggcctactcacgaatttggtcatgccctgttaaaacagaataaaatggtcctttaattatcatttttattgcattttttgtcctacccccc 25000211  T
351 attttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||| |  ||||| ||| |||||||||||||||||||||    
25000212 atttt-attctccaaaaacgtagagaaatgacagttttag 25000250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 232 - 346
Target Start/End: Original strand, 4623151 - 4623265
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||||||| |||||| ||| | ||||||||||| | ||||| ||  |||||||||||||||||  |||||||||||||||||||| | ||    
4623151 ttaattacacttttggtcatcgtgttttgacttactcacgaaattggtcctgcctctttaaaacagaacaaaattgtccttcaattatcatttttatggc 4623250  T
332 atttttcgtcctacc 346  Q
    ||||| |||||||||    
4623251 attttccgtcctacc 4623265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 317 - 408
Target Start/End: Original strand, 10721873 - 10721963
Alignment:
317 tatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctaccc 408  Q
    |||||| ||| ||||| |||| |||||||||||||||||||| ||||||||| ||||||||||||||||||||||| | |||||||||||||    
10721873 tatcatgttttttgcagttttagtcctacctcctattttcaa-ctccagaaacgtagagaaatgacagttttaggcagttttagacctaccc 10721963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 230 - 355
Target Start/End: Complemental strand, 6019314 - 6019189
Alignment:
230 gtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgtt 329  Q
    |||| |||||| |||||||| || ||| ||||| |||||||||||||  || | | |||||||||||||||||||| ||| || ||||||||||||||||    
6019314 gtttgattacatttttggtcatcatgttttggc-tactcacgaaactgatcttgctcttttaaaacagaacaaaactgtcttttaattatcatttttgtt 6019216  T
330 gcat-ttttcgtcctacctcctatttt 355  Q
    |||| |||||||||||||||| |||||    
6019215 gcattttttcgtcctacctcccatttt 6019189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 232 - 390
Target Start/End: Complemental strand, 24332106 - 24331945
Alignment:
232 ttaattacactttt-ggtcctcgtgtattggcctactcacgaaactagtcctaccctttt-aaaacagaacaaaacggtccttcaattatcat-ttttgt 328  Q
    |||||||||||||| |||| || ||| ||||| |||||||||||||  |||| || |||| ||||||||||||||||||||| |||||||||| ||||||    
24332106 ttaattacactttttggtcatcatgttttggcatactcacgaaactgatcctgccttttttaaaacagaacaaaacggtcctgcaattatcattttttgt 24332007  T
329 tgca-tttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||| |||||||||||||| || ||| | |  ||||| ||| | |||||||||||||||||||    
24332006 tgcattttttcgtcctaccccccattct-attctccaaaaacgcagagaaatgacagttttag 24331945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 232 - 357
Target Start/End: Original strand, 6018317 - 6018441
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||| ||||||| ||||||| |||  |||||||||||||| ||| |  ||||||||||||||||||||   | ||||||||||||||||||||||    
6018317 ttaattacatttttggttctcgtgttttgttctactcacgaaactggtcatgtccttttaaaacagaacaaaattat-cttcaattatcatttttgttgc 6018415  T
332 atttttcgtcctacctcctattttca 357  Q
    | |||| ||||||||  |||||||||    
6018416 agttttagtcctaccctctattttca 6018441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 232 - 346
Target Start/End: Original strand, 4219666 - 4219780
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||| ||||||||| |||| ||| | || ||| | ||| | || |||||||||||||||||   |||||| | ||||||||||||||||    
4219666 ttaattacacttttgatcctcgtgttttgggctatttacaaaaatggtcatgcctttttaaaacagaacaaagttgtcctttagttatcatttttgttgc 4219765  T
332 atttttcgtcctacc 346  Q
    |||||||||||||||    
4219766 atttttcgtcctacc 4219780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 317 - 408
Target Start/End: Original strand, 27307148 - 27307238
Alignment:
317 tatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctaccc 408  Q
    |||||| ||| ||||| |||| ||| |||||||||||||||| ||||||||| | | ||||||||||||||||||| | |||||||||||||    
27307148 tatcatgttttttgcagttttagtcttacctcctattttcaa-ctccagaaacgcatagaaatgacagttttaggcagttttagacctaccc 27307238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 170 - 228
Target Start/End: Complemental strand, 22616777 - 22616719
Alignment:
170 tggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    |||| |||||||||||||||||  |||||||||||||||||||||||||||| ||||||    
22616777 tggtggaccactctaaaactaaactttaccttattacaaatcagtcctcatacaaaata 22616719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 242 - 355
Target Start/End: Complemental strand, 4624757 - 4624644
Alignment:
242 ttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatttttcgtc 341  Q
    |||| |||||||||| ||  ||||||||||||| | ||| |  |  ||||||||| ||||||||  || |||||||||||||| ||||||||||||||||    
4624757 ttttcgtcctcgtgttttaacctactcacgaaattggtcatgtctctttaaaacataacaaaactatcattcaattatcatttatgttgcatttttcgtc 4624658  T
342 ctacctcctatttt 355  Q
    ||||| || |||||    
4624657 ctaccccccatttt 4624644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 317 - 407
Target Start/End: Original strand, 28494931 - 28495020
Alignment:
317 tatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacc 407  Q
    |||||| ||| ||||| |||| |||||||||||||||||| ||||||||||| | |||||| ||||| |||||||  | ||||||||||||    
28494931 tatcatgttttttgcagttttagtcctacctcctattttc-aactccagaaacgcagagaagtgacaattttaggtagttttagacctacc 28495020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 334 - 390
Target Start/End: Complemental strand, 27307499 - 27307444
Alignment:
334 ttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||| |||||||||||||||||||| ||||||||||| |||||||||||| ||||||    
27307499 ttttagtcctacctcctattttcaa-ctccagaaatgcagagaaatgacatttttag 27307444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 232 - 390
Target Start/End: Complemental strand, 41834602 - 41834445
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcat-ttttgttg 330  Q
    ||||||||||||||||||||||  | ||| ||  ||||||||| | ||||| ||  ||| | |  ||||||||| |||||  || |||||| |||| |||    
41834602 ttaattacacttttggtcctcgcattttgaccagctcacgaaaatggtcctgcctctttcagatcgaacaaaaccgtccta-aactatcatgtttttttg 41834504  T
331 catttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    || |||| |||||||||||||||||| |||||  |||| | |||||||||||||||||||    
41834503 cagttttagtcctacctcctattttc-aactcttgaaacgcagagaaatgacagttttag 41834445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 228
Target Start/End: Original strand, 12080498 - 12080556
Alignment:
170 tggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    |||| ||||||| ||| |||||  |||||||||||||||||||||||||||| ||||||    
12080498 tggtggaccactttaagactaaactttaccttattacaaatcagtcctcatacaaaata 12080556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 175 - 228
Target Start/End: Complemental strand, 33163794 - 33163741
Alignment:
175 gaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||| |||||||||  |||||||||||||||||||||| ||||| ||||||    
33163794 gaccactttaaaactaaactttaccttattacaaatcagtcttcatacaaaata 33163741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 183 - 228
Target Start/End: Original strand, 41417356 - 41417401
Alignment:
183 taaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||||| ||||||||||||||||||||||| ||||| ||||||    
41417356 taaaactaaattttaccttattacaaatcagtcatcatacaaaata 41417401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 175 - 215
Target Start/End: Complemental strand, 25654628 - 25654588
Alignment:
175 gaccactctaaaactaatttttaccttattacaaatcagtc 215  Q
    |||||||||||||||||  ||||||||||||||||||||||    
25654628 gaccactctaaaactaaactttaccttattacaaatcagtc 25654588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 226 - 390
Target Start/End: Complemental strand, 28290193 - 28290030
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    ||||| ||||||||||||||||||||    | ||| || |||||||||| | |||||| | |||| |||  ||||||||  |||||| || ||| || ||    
28290193 ataggcttaattacacttttggtcctaccattttgaccaactcacgaaaatggtcctatcatttttaaatcgaacaaaatcgtccttaaactat-atgtt 28290095  T
326 tgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    | ||||| |||| |||||| ||||   |||| ||||||||||| | | |||||||||||||||||    
28290094 ttttgcagttttagtcctatctccctatttccaactccagaaacgcacagaaatgacagttttag 28290030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 311 - 346
Target Start/End: Complemental strand, 13814190 - 13814155
Alignment:
311 ttcaattatcatttttgttgcatttttcgtcctacc 346  Q
    |||||||||||||||||||||| |||||||||||||    
13814190 ttcaattatcatttttgttgcacttttcgtcctacc 13814155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 217
Target Start/End: Complemental strand, 27579310 - 27579263
Alignment:
170 tggtcgaccactctaaaactaatttttaccttattacaaatcagtcct 217  Q
    |||| |||||||||||||||||  ||||||||||||||||||| ||||    
27579310 tggtggaccactctaaaactaaactttaccttattacaaatcattcct 27579263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 322 - 408
Target Start/End: Complemental strand, 16753022 - 16752938
Alignment:
322 tttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctaccc 408  Q
    ||||| ||||| |||| | |||| ||||||||||||| ||||||||| | ||| ||||| ||||||||||| | |||||||||||||    
16753022 ttttttttgcagttttagacctaactcctattttcaa-ctccagaaacgcagaaaaatggcagttttaggcag-tttagacctaccc 16752938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 390
Target Start/End: Complemental strand, 28495288 - 28495227
Alignment:
328 ttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||| |||| |||||||||||||||||| ||||||||||  | |||||||||| ||||||||    
28495288 ttgcagttttagtcctacctcctattttc-aactccagaaccgcagagaaatgatagttttag 28495227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 390
Target Start/End: Original strand, 32305916 - 32305977
Alignment:
328 ttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||| |||| |||||||||| ||||||||| |||||||||   |||||||||||||||||||    
32305916 ttgcagttttagtcctacctcttattttcaa-ctccagaaacacagagaaatgacagttttag 32305977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 228
Target Start/End: Complemental strand, 10237700 - 10237639
Alignment:
167 tgttggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||| |||||||||| ||||||  ||||||||||||||||| |||| || || ||||||    
10237700 tgttggtagaccactctagaactaaactttaccttattacaaattagtcatcgtacaaaata 10237639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 175 - 228
Target Start/End: Original strand, 29766571 - 29766624
Alignment:
175 gaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||||||| |||||  ||||||||||||||||| ||| |||||| ||||||    
29766571 gaccactctaagactaaactttaccttattacaaattagttctcatacaaaata 29766624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 228
Target Start/End: Original strand, 33752469 - 33752530
Alignment:
167 tgttggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||| ||| ||||||| |||||  |||||||||||| |||||| |||||||| ||||||    
33752469 tgttggtagactactctaagactaaactttaccttattaaaaatcaatcctcatacaaaata 33752530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 334 - 390
Target Start/End: Complemental strand, 14340849 - 14340793
Alignment:
334 ttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||| |||||| |||||  |||| ||||||| ||| |||||||||||||||||||||    
14340849 ttttagtcctatctccttatttccaactccaaaaacgtagagaaatgacagttttag 14340793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 177 - 221
Target Start/End: Original strand, 36055646 - 36055690
Alignment:
177 ccactctaaaactaatttttaccttattacaaatcagtcctcata 221  Q
    |||||||||||||||  ||||||||||||||||||| | ||||||    
36055646 ccactctaaaactaaactttaccttattacaaatcaattctcata 36055690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 40)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 227 - 413
Target Start/End: Original strand, 19176288 - 19176474
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
19176288 taggcttaattacacttttggtcctcgtgttttggcctactcacgaaactagtcctgcccttttaaaacagaacaaaacggtccttcaattatcattttt 19176387  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||| ||||||||||||||||||||||||| | |||||||||||| |||||||||| ||||||||||||| ||||    
19176388 gttgcatttttcgtccgacctcctattttcaaactccagaaacgcagagaaatgacaattttaggcggttttagacctacccatatg 19176474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 232 - 413
Target Start/End: Complemental strand, 13225181 - 13225000
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||    
13225181 ttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcttgcccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 13225082  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||| ||||||||||||| ||||    
13225081 atttttcgtcctacctcctattttcaaactccagaaacgcagagaaatggcagttttaggcggttttagacctacccctatg 13225000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 232 - 413
Target Start/End: Original strand, 9928912 - 9929093
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| |||  |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
9928912 ttaattacacttttggtcctcgtgttttgatctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 9929011  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||| ||||||||||||||||| | ||||||||| ||||||||||||| ||||||||||||||||||    
9929012 atttttcgtcctacctccttttttcaaactccagaaacgcagagaaatgtcagttttaggcggttttagacctacccttatg 9929093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 232 - 413
Target Start/End: Complemental strand, 41681676 - 41681495
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41681676 ttaattacacttttggtcctcgtgttttggcctaatcacgaaactggtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 41681577  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||| |||||||||||||||||||| | |||||||||  |||||||||||| ||||||||||||| ||||    
41681576 atttttcgtcctacctgctattttcaaactccagaaacgcagagaaatggtagttttaggcggttttagacctacccctatg 41681495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 229 - 413
Target Start/End: Complemental strand, 12572396 - 12572212
Alignment:
229 ggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgt 328  Q
    |||||||||||||||||||||||||||| |||| |||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||    
12572396 ggtttaattacacttttggtcctcgtgttttggtctactcacgaaactagtcatgctcttttaaaacagaacaaaacggtccttcaattatcatttttgt 12572297  T
329 tgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||||||||||||||||||||||||||| | ||||||||  ||||||||||||| |||||| |||||| ||||    
12572296 tgcatttttcgtcctacctcctattttcaaactccagaaacgcagagaaattgcagttttaggcggttttagatctacccctatg 12572212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 232 - 405
Target Start/End: Complemental strand, 31133762 - 31133589
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| |||||||||||||||||||  |||| |||||||||||||||||||||||||||||||||||| |||||||||||    
31133762 ttaattacacttttggtcctcgtgttttggcctactcacgaaactgatcctgcccttttaaaacagaacaaaacggtccttcaattattatttttgttgc 31133663  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagaccta 405  Q
    |||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||| |||| ||||||||||    
31133662 atttttcgtcatacctcctattttcaaactccagaaatgcagagaaatgacggttttatgcggttttagaccta 31133589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 232 - 413
Target Start/End: Original strand, 44831250 - 44831431
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||| ||| ||||||||||||||||| | ||||| |||||||||||||||||||||||||||||| |||||||||||||||||    
44831250 ttaattacacttttggtcctcatgttttggcctactcacgaaattggtcctgcccttttaaaacagaacaaaacggtccttccattatcatttttgttgc 44831349  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||| ||| | |||||||||| |||||||||||| ||||||||| ||| ||||    
44831350 atttttcgtcctacctcctattttcaaactccataaacgcagagaaatgatagttttaggcggttttagacctgcccctatg 44831431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 232 - 413
Target Start/End: Complemental strand, 11656999 - 11656818
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| ||||   |||||||||||||||||||| ||||||||||||||||||||||||||    
11656999 ttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcccggccttttaaaacagaacaaaatggtccttcaattatcatttttgttgc 11656900  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||||  ||||||||||||  | ||||||||||| ||||    
11656899 atttttcgtcctacctcctattttcaaactccagaaacgcagagaaatagcagttttaggcgattgtagacctacccctatg 11656818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 232 - 413
Target Start/End: Complemental strand, 33328682 - 33328501
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||| ||||||||||||||||| || |||||||||||||||||||| | | ||||||||||| ||||||||||||||||||||||||||||||||||    
33328682 ttaattagacttttggtcctcgtgttttagcctactcacgaaactagtcatgctcttttaaaacataacaaaacggtccttcaattatcatttttgttgc 33328583  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||| |||||| |||||||||||||||||| | ||||||||| ||||||||||||| |||| |||||||| ||||    
33328582 atttttcgtcccacctcccattttcaaactccagaaacgcagagaaatggcagttttaggcggttttaaacctacccctatg 33328501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 227 - 413
Target Start/End: Original strand, 33742920 - 33743105
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| ||| ||||||||||||||| ||| | |||||||||||||||||||| ||||| ||||||||||||||||    
33742920 taggcttaattacacttttggtcctcgtgttttgacctactcacgaaactggtcttgcccttttaaaacagaacaaa-cggtctttcaattatcattttt 33743018  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    | ||||||||||||||||||||||||||||| || ||||||| | ||||||||||||||||||||| | ||||||||||||| ||||    
33743019 gatgcatttttcgtcctacctcctattttcataccccagaaacgcagagaaatgacagttttaggcagttttagacctacccctatg 33743105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 227 - 388
Target Start/End: Complemental strand, 34541095 - 34540934
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| | ||||||||||| ||||||| |||||||||||||||||||||    
34541095 taggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgctcttttaaaacataacaaaatggtccttcaattatcattttt 34540996  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagtttt 388  Q
    |||||||||||||||||||||||||||||||||||  ||||| | |||||||||| ||||||    
34540995 gttgcatttttcgtcctacctcctattttcaaacttaagaaacgcagagaaatgatagtttt 34540934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 226 - 389
Target Start/End: Original strand, 41681131 - 41681292
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    ||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||    
41681131 ataggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcatttt 41681230  T
326 tgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagtttta 389  Q
    ||||||||||||||||||||| || ||||| |  ||||| ||| | ||||||||||||||||||    
41681231 tgttgcatttttcgtcctacc-cccatttt-attctccaaaaacgcagagaaatgacagtttta 41681292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 227 - 390
Target Start/End: Complemental strand, 19176837 - 19176675
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| |||||||||||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||||||    
19176837 taggcttaattacacttttggtcctcgtgttttggcctactcacgtaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcattttt 19176738  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||||||| || ||||| |  ||||| ||| | ||| |||||||||||||||    
19176737 gttgcatttttcgtcctaccccccatttt-attctccaaaaacgcagacaaatgacagttttag 19176675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 227 - 390
Target Start/End: Original strand, 12571861 - 12572024
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||    
12571861 taggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggttctacccttttaaaacagaacaaaacggtcattcaattatcattttt 12571960  T
327 gttgcatttttcgtccta-cctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||||| || || ||||| |  ||||| ||| | |||||||||||||||||||    
12571961 gttgcatttttcgtcctaaccccccatttt-attctccaaaaacgcagagaaatgacagttttag 12572024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 226 - 390
Target Start/End: Original strand, 31133217 - 31133380
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    ||||| ||||||||||||||||||||||||| ||| ||||||||||||||| ||||  ||||||||||||| |||||||| ||||||||| |||||||||    
31133217 ataggcttaattacacttttggtcctcgtgttttgccctactcacgaaactggtcccgcccttttaaaacaaaacaaaacagtccttcaagtatcatttt 31133316  T
326 tgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||||||||| || ||||| |  ||||| ||| |||||||||||||||||||||    
31133317 tgttgcatttttcgtcctaccccccatttt-attctccaaaaacgtagagaaatgacagttttag 31133380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 228 - 346
Target Start/End: Original strand, 33328157 - 33328275
Alignment:
228 aggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttg 327  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||  || | |||||||||||||||||||||||||||||||| |||||||||||    
33328157 aggtttaattacacttttggtcctcgtgttttggcctactcacgaaactgatcatgcccttttaaaacagaacaaaacggtccttcaagtatcatttttg 33328256  T
328 ttgcatttttcgtcctacc 346  Q
    |||||||||||||||||||    
33328257 ttgcatttttcgtcctacc 33328275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 227 - 355
Target Start/End: Original strand, 11656453 - 11656581
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||||| ||| | |||||||||||| |||||||||||||||||||||| |||||||    
11656453 taggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcatgcccttttaaaactgaacaaaacggtccttcaattaccattttt 11656552  T
327 gttgcatttttcgtcctacctcctatttt 355  Q
    |||||||||||||||||||| || |||||    
11656553 gttgcatttttcgtcctaccccccatttt 11656581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 227 - 384
Target Start/End: Original strand, 4629795 - 4629952
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| |||||| |||||||  | ||||||| ||||| || |||||||||| ||||| ||||||||||| |||||||||||||| ||||||||||||||||    
4629795 taggcttaattgcacttttaattctcgtgttttggcatattcacgaaactggtcctgcccttttaaaatagaacaaaacggtcattcaattatcattttt 4629894  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacag 384  Q
     |||||||||||||| |||||||||||||||||||||||||| | | |||||||||||    
4629895 attgcatttttcgtcttacctcctattttcaaactccagaaacgcaaagaaatgacag 4629952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 232 - 355
Target Start/End: Complemental strand, 9930199 - 9930076
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||| | ||||||||||||||||||| ||||| ||||||||||| ||||||||| |||||||||| |||||||||||||||    
9930199 ttaattacacttttggtcctcgtattttggcctactcacgaaactggtcctgcccttttaaaatagaacaaaatggtccttcaactatcatttttgttgc 9930100  T
332 atttttcgtcctacctcctatttt 355  Q
    ||||||||||||||| || |||||    
9930099 atttttcgtcctaccccccatttt 9930076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 233 - 390
Target Start/End: Original strand, 13224645 - 13224800
Alignment:
233 taattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgca 332  Q
    ||||||||||||||||| |||||| ||||||||||||||||||| ||| | ||||||||||||||||||||||  ||||||||||||||||||||||| |    
13224645 taattacacttttggtcttcgtgttttggcctactcacgaaactggtc-tgcccttttaaaacagaacaaaacaatccttcaattatcatttttgttgaa 13224743  T
333 tttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
13224744 tttttcgtcctaccccccatttt-attctccaaaaacgcagagaaatgacagttttag 13224800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 227 - 390
Target Start/End: Complemental strand, 44831792 - 44831630
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||| ||||||||||||||||||| ||||| ||||||||||||| ||||| | |||||||||||||||||||||||  ||||||||||||||||    
44831792 taggcttaataacacttttggtcctcgtgttttggcatactcacgaaactggtcctgctcttttaaaacagaacaaaacggttattcaattatcattttt 44831693  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||| |||||||| || ||||| |  ||||| |||   |||||||||||||||||||    
44831692 gttgcatttttggtcctaccccccatttt-attctccaaaaacacagagaaatgacagttttag 44831630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 232 - 338
Target Start/End: Complemental strand, 9178177 - 9178071
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| |||||||||||||||||||  || | |||| ||||||||||||||||||||||||||| |||||||||||||||    
9178177 ttaattacacttttggtcctcgtgttttggcctactcacgaaactgatcatgccctcttaaaacagaacaaaacggtccttcaagtatcatttttgttgc 9178078  T
332 atttttc 338  Q
    |||||||    
9178077 atttttc 9178071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 227 - 337
Target Start/End: Complemental strand, 11337069 - 11336959
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| |||||||||||||||||| |||||| ||||| ||||||||||| | ||||  |||||||||||||||| ||||||||| ||||||||||||||||    
11337069 taggcttaattacacttttggtcttcgtgttttggcttactcacgaaattggtcccgcccttttaaaacagaataaaacggtctttcaattatcattttt 11336970  T
327 gttgcattttt 337  Q
    |||||||||||    
11336969 gttgcattttt 11336959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 321 - 413
Target Start/End: Original strand, 9177724 - 9177816
Alignment:
321 atttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||||| ||| |||||| |||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||| ||||    
9177724 atttttgttgcatttttcatcccacctcccattttcaaactccagaaacgaagagaaatgacagttttaggcggttttagacctacccctatg 9177816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 287 - 390
Target Start/End: Complemental strand, 33743406 - 33743304
Alignment:
287 ttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagtt 386  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||| || ||||| |  ||||| ||| | |||||||| ||||||    
33743406 ttttaaaacagaacaaaacggtttttcaattatcatttttgttgcatttttcgtcctaccccccatttt-attctccaaaaacgcagagaaataacagtt 33743308  T
387 ttag 390  Q
    ||||    
33743307 ttag 33743304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 230 - 390
Target Start/End: Complemental strand, 4630330 - 4630177
Alignment:
230 gtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgtt 329  Q
    ||||||||||||||||| || |||||| |||| |||||||||||| | ||||| |  ||||||||||||| | ||||||||||||||||      |||||    
4630330 gtttaattacacttttgatcatcgtgttttgggctactcacgaaattggtcctgcatttttaaaacagaatacaacggtccttcaatta------ttgtt 4630237  T
330 gcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||| ||||||| || ||||| |  ||||| ||| | ||| |||||||||||||||    
4630236 gcatttttcatcctaccccccatttt-attctccaaaaacgcagaaaaatgacagttttag 4630177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 227 - 355
Target Start/End: Original strand, 10918124 - 10918252
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||||||||||||| |||| |||||||||| |||  |||||||||||| | ||| | ||   |||||||||| |||||  ||||||||| ||||||||||    
10918124 taggtttaattacattttttgtcctcgtgttttgatctactcacgaaattggtcttgcctccttaaaacagagcaaaattgtccttcaaatatcattttt 10918223  T
327 gttgcatttttcgtcctacctcctatttt 355  Q
    |||||||||||| || |||| || |||||    
10918224 gttgcatttttcatcataccccccatttt 10918252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 240 - 341
Target Start/End: Complemental strand, 8074085 - 8073985
Alignment:
240 acttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatttttcg 339  Q
    ||||||||||||||||| |||||||| |||||||| |  || |  ||||||||||||||||||||   |||||||||||||| |||||||||||||| ||    
8074085 acttttggtcctcgtgttttggcctattcacgaaaatgatcatgtccttttaaaacagaacaaaatcatccttcaattatca-ttttgttgcattttacg 8073987  T
340 tc 341  Q
    ||    
8073986 tc 8073985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 170 - 228
Target Start/End: Original strand, 18756431 - 18756489
Alignment:
170 tggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    |||| |||||||||||||||||| |||||||||||||||||| ||||||||| ||||||    
18756431 tggtggaccactctaaaactaatctttaccttattacaaatctgtcctcatacaaaata 18756489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 167 - 228
Target Start/End: Original strand, 28220794 - 28220855
Alignment:
167 tgttggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||| |||||||||||||||||  |||| ||||||||||||||||||||||| ||||||    
28220794 tgttggtggaccactctaaaactaagctttatcttattacaaatcagtcctcatacaaaata 28220855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 308 - 355
Target Start/End: Original strand, 43958264 - 43958311
Alignment:
308 tccttcaattatcatttttgttgcatttttcgtcctacctcctatttt 355  Q
    |||||||||||||||||||||||||||||||||||||||  |||||||    
43958264 tccttcaattatcatttttgttgcatttttcgtcctaccctctatttt 43958311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 228
Target Start/End: Complemental strand, 3038689 - 3038631
Alignment:
170 tggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    |||| |||||||||||||||||  ||||||||||||||||||| || ||||| ||||||    
3038689 tggtggaccactctaaaactaaactttaccttattacaaatcaatcatcatacaaaata 3038631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 175 - 228
Target Start/End: Original strand, 23176556 - 23176609
Alignment:
175 gaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    |||||||||||||||||  |||| |||||||||||| |||||||||| ||||||    
23176556 gaccactctaaaactaagctttatcttattacaaattagtcctcatacaaaata 23176609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 175 - 228
Target Start/End: Complemental strand, 34686054 - 34686001
Alignment:
175 gaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||||||| |||||  ||||| |||||||||||||||||||||| ||||||    
34686054 gaccactctaagactaaactttactttattacaaatcagtcctcatacaaaata 34686001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 390
Target Start/End: Original strand, 5730815 - 5730977
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||    | ||| || |||||||||| |||||||| | |||| |||   |||||||  |||||| || ||| || |||    
5730815 taggcttaattacacttttggtcctaccattttgaccaactcacgaaaatagtcctatcttttttaaatcaaacaaaatcgtccttaaactat-atgttt 5730913  T
327 gttgcatttttcgtcctacctcc-tattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
     ||||  |||| ||||||||||| |||||| || ||||||||| ||| |||||||||||||||||    
5730914 tttgctgttttagtcctacctccctatttttaa-ctccagaaacgtacagaaatgacagttttag 5730977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 176 - 228
Target Start/End: Complemental strand, 7290997 - 7290945
Alignment:
176 accactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||||||||||||  |||| |||||||||||||| |||||||| ||||||    
7290997 accactctaaaactaaactttatcttattacaaatcaatcctcatacaaaata 7290945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 227 - 390
Target Start/End: Complemental strand, 35427360 - 35427198
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||  | ||| || |||||||||| | || |||||  ||| |||| ||||||||  |||| | |||||| || |||    
35427360 taggcttaattacacttttggtcctcgcattttgaccaactcacgaaaatggttctacctcttttaaaccgaacaaaatcgtccctaaattat-atattt 35427262  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
     ||||| |||| |||| | ||||   |||| ||||||| ||| | | |||||||||||||||||    
35427261 tttgcagttttagtcccatctccctatttccaactccataaacgcacagaaatgacagttttag 35427198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 228
Target Start/End: Original strand, 4108676 - 4108737
Alignment:
167 tgttggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||| ||||||| |||||||||  |||| ||||||||||| ||||| ||||| ||||||    
4108676 tgttggtggaccactttaaaactaagctttatcttattacaaaacagtcttcatacaaaata 4108737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 226 - 262
Target Start/End: Original strand, 9177664 - 9177700
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggc 262  Q
    ||||| ||||||||||||||||||||||||| |||||    
9177664 ataggcttaattacacttttggtcctcgtgttttggc 9177700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 334 - 390
Target Start/End: Original strand, 18805267 - 18805322
Alignment:
334 ttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||| |||||||||||||| ||||| |||||||||   |||||||||||||||||||    
18805267 ttttagtcctacctcctatcttcaa-ctccagaaacacagagaaatgacagttttag 18805322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 40)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 227 - 413
Target Start/End: Complemental strand, 19591072 - 19590886
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||| ||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||    
19591072 taggcttaattacacttttggtactcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcattttt 19590973  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||| ||||    
19590972 gttgcatttttcgtcctacctcctattttcaaactccagaaacgcagagaaatgacagttttaggcggttttagacctacccctatg 19590886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 227 - 413
Target Start/End: Complemental strand, 38859188 - 38859002
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||| | ||||| |||||||||||||||||||||||||||||| ||||||||||||    
38859188 taggcttaattacacttttggtcctcgtgttttggcctactcacgaaattggtcctgcccttttaaaacagaacaaaacggtccttccattatcattttt 38859089  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||| ||||||||| ||| ||||    
38859088 gttgcatttttcgtcctacctcctattttcaaactccagaaacgcagagaaatgatagttttaggcggttttagacctgcccctatg 38859002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 226 - 413
Target Start/End: Original strand, 32004611 - 32004798
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    ||||| ||||||||||||||||||||||||| ||||||||||||||||| |  |||| ||||||||||||||||||||| ||||||||||||||||||||    
32004611 ataggcttaattacacttttggtcctcgtgttttggcctactcacgaaattgatcctgcccttttaaaacagaacaaaatggtccttcaattatcatttt 32004710  T
326 tgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||| |||||||||||||||||||||||||||| | |||||||||||||||||| |||| ||||||||||||| ||||    
32004711 tgttgcatttttcgccctacctcctattttcaaactccagaaacgcagagaaatgacagttttaagcggttttagacctacccctatg 32004798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 227 - 413
Target Start/End: Complemental strand, 37787314 - 37787128
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||| ||||||||||||||||| ||||||||||||||||||| ||||| | |||||||| |||||||||||||| |||||||||||||||||    
37787314 taggcttaattatacttttggtcctcgtgttttggcctactcacgaaactggtcctgctcttttaaatcagaacaaaacggttcttcaattatcattttt 37787215  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| ||| | ||||||||||||| ||||    
37787214 gttgcatttttcgtcctacctcctattttcaaactccagaaacgcagagaaatgacagtttttggcagttttagacctacccctatg 37787128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 232 - 413
Target Start/End: Complemental strand, 19830961 - 19830781
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||||||||||| ||||| |||||  |||||||||||| ||||||||||| ||||||||||||||||||||||    
19830961 ttaattacacttttggtcctcgtgttttggcctactcacaaaactggtcctgtccttttaaaacataacaaaacggtacttcaattatcatttttgttgc 19830862  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||| ||||||||||||||||||||||||||||||   ||||||||||||||||||||||| ||||||||||||| ||||    
19830861 attttt-gtcctacctcctattttcaaactccagaaacacagagaaatgacagttttaggcggttttagacctacccctatg 19830781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 242 - 407
Target Start/End: Original strand, 29099863 - 29100028
Alignment:
242 ttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatttttcgtc 341  Q
    ||||||||||||||| |||||||||||||||||||  |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29099863 ttttggtcctcgtgttttggcctactcacgaaactgatcctgcccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatttttcgtc 29099962  T
342 ctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacc 407  Q
    ||||||||||||||||||| ||||||| ||||| ||||||||||||||||  | ||||||||||||    
29099963 ctacctcctattttcaaaccccagaaacgtagataaatgacagttttaggaagttttagacctacc 29100028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 232 - 413
Target Start/End: Original strand, 35288906 - 35289087
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||||||| |||| | ||||||||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||    
35288906 ttaattacacttttggtcatcgtattttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaatggtccttcaattatcatttttgttgc 35289005  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||| || |||||||||||||||||||   |||||||||||||||||| |||| ||||||||||||| ||||    
35289006 atttttcgtcctacttcatattttcaaactccagaaacacagagaaatgacagttttaagcggttttagacctacccctatg 35289087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 227 - 406
Target Start/End: Original strand, 2658837 - 2659016
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| |||||||||||||| |||||||||| ||||||||||||||||||| ||||| ||||||||||| ||||||||| |||||||||||||||||||||    
2658837 taggcttaattacactttttgtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaatagaacaaaatggtccttcaattatcattttt 2658936  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctac 406  Q
    ||||||||||||||| |||||||||||||||||||||| ||| | ||||||||| ||||||||||| | |||||||||||    
2658937 gttgcatttttcgtcatacctcctattttcaaactccaaaaacgcagagaaatggcagttttaggccgttttagacctac 2659016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 226 - 413
Target Start/End: Original strand, 34533788 - 34533975
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    ||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||| | | |||||||||||||| |||| |||| |||||||||||||||    
34533788 ataggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcatgctcttttaaaacagaataaaatggtcattcaattatcatttt 34533887  T
326 tgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||| ||||||||||||||||||||||||||| ||| | |||||||||||| |||||||| | ||||||||||||| ||||    
34533888 tgttgcattttccgtcctacctcctattttcaaactccaaaaacgcagagaaatgacacttttaggcagttttagacctacccctatg 34533975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 232 - 407
Target Start/End: Complemental strand, 4641983 - 4641811
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| |||||||||||||   ||| |||||  |||||||||||||||||||||||||||||||||||||||||||||||    
4641983 ttaattacacttttggtcctcgtgttttggcctactcac---actggtcctgtccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 4641887  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacc 407  Q
    || ||||||||||| |||||||||||||||| ||||| | ||||||||||||||||||||||| ||||||| ||||    
4641886 atatttcgtcctacgtcctattttcaaactctagaaacgcagagaaatgacagttttaggcggttttagacatacc 4641811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 225 - 390
Target Start/End: Original strand, 19830416 - 19830580
Alignment:
225 aataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattt 324  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||    
19830416 aataggtttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcttgcccttttaaaacagaacaaaacggtccttcaattatcattt 19830515  T
325 ttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
19830516 ttgttgcatttttcgtcctaccccccatttt-attctccaaaaacgcagagaaatgacagttttag 19830580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 227 - 408
Target Start/End: Original strand, 23952728 - 23952910
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcc-tactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    |||| ||||||||||||||||||||||||| ||| || ||||||||||| | ||| | ||||||||||||||||||||||||||||||||||||||||||    
23952728 taggcttaattacacttttggtcctcgtgttttgaccctactcacgaaattggtcatgcccttttaaaacagaacaaaacggtccttcaattatcatttt 23952827  T
326 tgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctaccc 408  Q
     ||||||||||||||||||||| |||||||||||| ||||||| | |||||||||| |||||||||| | |||| ||||||||    
23952828 ggttgcatttttcgtcctaccttctattttcaaaccccagaaacgcagagaaatgatagttttaggcagttttaaacctaccc 23952910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 232 - 390
Target Start/End: Original strand, 19590528 - 19590685
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
19590528 ttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 19590627  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||| ||||||| || ||||| |  ||||| |||   |||||||||||||||||||    
19590628 atttttcatcctaccccccatttt-attctccaaaaacccagagaaatgacagttttag 19590685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 232 - 390
Target Start/End: Original strand, 37786770 - 37786927
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| |||||||||| |||||||| ||||| ||||||||||||| ||||||||||||||||||||||||||||||||||    
37786770 ttaattacacttttggtcctcgtgttttggcctacttacgaaactggtcctgcccttttaaaacataacaaaacggtccttcaattatcatttttgttgc 37786869  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
37786870 atttttcgtcctaccccccatttt-attctccaaaaacgcagagaaatgacagttttag 37786927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 219 - 390
Target Start/End: Complemental strand, 34534346 - 34534176
Alignment:
219 atataaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaatta 318  Q
    ||||||| |||| ||||||| ||||||||| ||||||| |||||||||||||||||||  |||| ||| |||||||||||||||||||||||||||||||    
34534346 atataaagtaggcttaattatacttttggttctcgtgttttggcctactcacgaaactgatcctgcccatttaaaacagaacaaaacggtccttcaatta 34534247  T
319 tcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||||||||||||||| || ||||| |  ||||| |||   |||||||||||||||||||    
34534246 tcatttttgttgcatttttcgtcctaccccccatttt-attctccaaaaaaacagagaaatgacagttttag 34534176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 224 - 355
Target Start/End: Complemental strand, 35289451 - 35289320
Alignment:
224 aaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatt 323  Q
    ||||||| ||||||||||||||| ||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||    
35289451 aaataggcttaattacacttttgatcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcatt 35289352  T
324 tttgttgcatttttcgtcctacctcctatttt 355  Q
    || ||||||||||||||| |||| || |||||    
35289351 ttggttgcatttttcgtcataccccccatttt 35289320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 228 - 390
Target Start/End: Original strand, 4641439 - 4641600
Alignment:
228 aggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttg 327  Q
    ||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||| | ||||| ||||| |||||||||||| |||||||||||||||||    
4641439 aggtttaattacacttttggtcctcgtgttttggcttactcacgaaactggtcctgctcttttgaaacataacaaaacggtcattcaattatcatttttg 4641538  T
328 ttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||||||| || ||||| |  ||||| ||||| |||||||||| ||||||||    
4641539 ttgcatttttcgtcctaccccccatttt-attctccaaaaatgcagagaaatgatagttttag 4641600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 228 - 390
Target Start/End: Complemental strand, 29100397 - 29100236
Alignment:
228 aggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttg 327  Q
    ||||||||||||||||||||||||||||| |||| |||||||| ||| | ||||| |||||||||||||||||||||||||| |||||||||||||||||    
29100397 aggtttaattacacttttggtcctcgtgttttggtctactcacaaaattggtcctgcccttttaaaacagaacaaaacggtctttcaattatcatttttg 29100298  T
328 ttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||| |||||||| || ||||| |  ||||| ||| | |||||||| ||||||||||    
29100297 ttgcattttttgtcctaccccccatttt-attctccaaaaacgcagagaaataacagttttag 29100236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 232 - 390
Target Start/End: Original strand, 38858646 - 38858803
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||| ||||||||||||||||||| ||||| ||||||||||||| ||||| | |||||||||||||||||||||||| |||||||||||||||||||||    
38858646 ttaataacacttttggtcctcgtgttttggcatactcacgaaactggtcctgctcttttaaaacagaacaaaacggtcattcaattatcatttttgttgc 38858745  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||| |||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
38858746 atttttggtcctaccccccatttt-attctccaaaaacgcagagaaatgacagttttag 38858803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 232 - 390
Target Start/End: Complemental strand, 32005156 - 32004999
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||| ||| ||||| ||||||||||||| ||| | ||||||||||| ||||||||||||||||| ||||||||||||||||||    
32005156 ttaattacacttttggtcctcatgttttggcatactcacgaaactggtcatgcccttttaaaatagaacaaaacggtcctttaattatcatttttgttgc 32005057  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||  || ||||| |  ||||| ||| | |||||||||||||||||||    
32005056 atttttcgtcctactccccatttt-attctccaaaaacgcagagaaatgacagttttag 32004999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 227 - 390
Target Start/End: Complemental strand, 2659387 - 2659225
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||| |||||||||||| || |||||||| ||| |||||| ||| | |||||||||||||||||||||||||| ||||||||||||||||    
2659387 taggcttaattacaattttggtcctcgcgttttggcctattcatgaaactggtcttgcccttttaaaacagaacaaaacggtcattcaattatcattttt 2659288  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||| ||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
2659287 gttgcatttttcatcctaccccccatttt-attctccaaaaacgcagagaaatgacagttttag 2659225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 223 - 341
Target Start/End: Complemental strand, 4478251 - 4478133
Alignment:
223 aaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcat 322  Q
    ||||||||||||| |||||||||| ||||||||| ||||||||||||||||||| ||||| |||||||||||||||| || |  ||||||||||||||||    
4478251 aaaataggtttaagtacacttttgatcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaataacattgtccttcaattatcat 4478152  T
323 ttttgttgcatttttcgtc 341  Q
    |||||||||||||||||||    
4478151 ttttgttgcatttttcgtc 4478133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 227 - 345
Target Start/End: Original strand, 38160949 - 38161067
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| |||||||||||||||||||||| || ||||||||||||||||| || |||| |||||||||||||||||||||  ||||||||||||| ||||||    
38160949 taggcttaattacacttttggtcctcgggttttggcctactcacgaaaataatcctgcccttttaaaacagaacaaaattgtccttcaattattattttt 38161048  T
327 gttgcatttttcgtcctac 345  Q
    |||||||||||||||||||    
38161049 gttgcatttttcgtcctac 38161067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 235 - 390
Target Start/End: Complemental strand, 23953268 - 23953114
Alignment:
235 attacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgcatt 334  Q
    |||||| ||||||||||||||| |||  |||||||||||||| ||||  |||||| ||||||||||||||||||||||||||||||||||||||||||||    
23953268 attacatttttggtcctcgtgttttgatctactcacgaaactggtcccgccctttcaaaacagaacaaaacggtccttcaattatcatttttgttgcatt 23953169  T
335 tttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||| |||| || ||||| |  ||||| ||| | |||||||| ||||||||||    
23953168 tttcgtcataccccccatttt-attctccaaaaacgcagagaaataacagttttag 23953114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 218 - 355
Target Start/End: Original strand, 28583428 - 28583565
Alignment:
218 catataaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaatt 317  Q
    |||||| |||||| ||||||||||||||||||||||||| |||||||||||| || | | || || ||||||||||||| || ||||| |||||||||||    
28583428 catatataataggcttaattacacttttggtcctcgtgttttggcctactcatgagattggttctgcccttttaaaacataataaaactgtccttcaatt 28583527  T
318 atcatttttgttgcatttttcgtcctacctcctatttt 355  Q
    ||||||||| ||||||||||||||||||| || |||||    
28583528 atcatttttattgcatttttcgtcctaccccccatttt 28583565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 232 - 355
Target Start/End: Complemental strand, 28584464 - 28584341
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||| |||||||||  |||||||| |||||||| | ||| |  ||||||||||||||||||||  ||||||||||||||||||||||||     
28584464 ttaattacacttttcgtcctcgtgctttggcctattcacgaaattggtcatgtccttttaaaacagaacaaaattgtccttcaattatcatttttgttgt 28584365  T
332 atttttcgtcctacctcctatttt 355  Q
    |||||||||| |||| || |||||    
28584364 atttttcgtcttaccccccatttt 28584341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 328 - 413
Target Start/End: Original strand, 4477800 - 4477885
Alignment:
328 ttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||| |||| |||||||||||||||||||||||||||||| | || |||||||||||||| ||  | ||||||||||||| ||||    
4477800 ttgcagttttagtcctacctcctattttcaaactccagaaacgcagggaaatgacagtttttggtagttttagacctacccctatg 4477885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 170 - 228
Target Start/End: Original strand, 22955076 - 22955134
Alignment:
170 tggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    |||| |||||||||||||||||  ||||||||||||||||||||| |||||| ||||||    
22955076 tggtggaccactctaaaactaaactttaccttattacaaatcagttctcatacaaaata 22955134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 170 - 228
Target Start/End: Complemental strand, 49002508 - 49002450
Alignment:
170 tggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    |||| |||||||||||||||||  ||||||| |||||||||||||||||||| ||||||    
49002508 tggtggaccactctaaaactaaactttacctcattacaaatcagtcctcatacaaaata 49002450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 175 - 228
Target Start/End: Complemental strand, 7743209 - 7743156
Alignment:
175 gaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    |||||||||||||||||  |||||||||||||||| ||| ||||||||||||||    
7743209 gaccactctaaaactaaactttaccttattacaaagcagccctcatataaaata 7743156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 176 - 228
Target Start/End: Original strand, 8133329 - 8133381
Alignment:
176 accactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||||||||||||  |||||||||||||||||||||| |||| |||||||    
8133329 accactctaaaactaaactttaccttattacaaatcagtcttcatgtaaaata 8133381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 176 - 228
Target Start/End: Complemental strand, 40382167 - 40382115
Alignment:
176 accactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||||||||||||  ||||||||||||||||||||||| |||| ||||||    
40382167 accactctaaaactaaactttaccttattacaaatcagtccgcatacaaaata 40382115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 232 - 390
Target Start/End: Original strand, 9181535 - 9181692
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||    | ||| || |||||||||| | |||||| | |||| |||  ||||||||  |||||| || ||| |||||| ||||    
9181535 ttaattacacttttggtcctaccattttgaccaactcacgaaaatggtcctatcttttttaaatcgaacaaaatcgtccttaaactat-attttttttgc 9181633  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    | |||| |||||| ||||   |||| ||||||||||| | | |||||||||||||||||    
9181634 agttttagtcctatctccctatttccaactccagaaacgcacagaaatgacagttttag 9181692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 221 - 293
Target Start/End: Complemental strand, 787340 - 787267
Alignment:
221 ataaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacc-cttttaaa 293  Q
    |||| ||||||||||||||||||||||| ||||| | ||| || |||||||||| | |||||||| ||||||||    
787340 ataagataggtttaattacacttttggtgctcgtattttgaccaactcacgaaaatggtcctacctcttttaaa 787267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 167 - 228
Target Start/End: Complemental strand, 5781802 - 5781741
Alignment:
167 tgttggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    |||||||  |||||| ||||||||| |||||| |||||||||||||||| ||||| ||||||    
5781802 tgttggtgcaccactttaaaactaagttttactttattacaaatcagtcatcatacaaaata 5781741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 176 - 228
Target Start/End: Complemental strand, 4902598 - 4902546
Alignment:
176 accactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    ||||||||||||||||  ||||||||||||||||| ||| |||||| ||||||    
4902598 accactctaaaactaaactttaccttattacaaattagtactcatacaaaata 4902546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 228
Target Start/End: Original strand, 4618519 - 4618577
Alignment:
170 tggtcgaccactctaaaactaatttttaccttattacaaatcagtcctcatataaaata 228  Q
    |||| |||||||||||||||||  |||| |||| |||||||||||| ||||| ||||||    
4618519 tggtggaccactctaaaactaaactttatcttactacaaatcagtcatcatacaaaata 4618577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 224 - 390
Target Start/End: Complemental strand, 25637749 - 25637584
Alignment:
224 aaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatt 323  Q
    |||||| |||||||||||||||||||||    | ||| || |||||||||| | |||||| | |||| |||  ||||||||  |||||| || ||| ||     
25637749 aaatagatttaattacacttttggtcctaccattttgaccaactcacgaaaatggtcctatcttttttaaatcgaacaaaatcgtccttaaactat-atg 25637651  T
324 tttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||| ||||| |||| |||||| ||||   |||| |||||||||||   | |||||||||||||||||    
25637650 ttttttgcagttttagtcctatctccctatttccaactccagaaacacacagaaatgacagttttag 25637584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 390
Target Start/End: Original strand, 35578986 - 35579058
Alignment:
317 tatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||| ||| ||||| ||||  |||||| |||||||||||| ||||||||| | |||||||||||| ||||||    
35578986 tatcatgttttttgcagttttaatcctacatcctattttcaa-ctccagaaacgcagagaaatgacatttttag 35579058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 317 - 408
Target Start/End: Original strand, 9393823 - 9393913
Alignment:
317 tatcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctaccc 408  Q
    |||||| ||| ||||  |||| |||||||||||||||||||| |||||||||   || ||||||||||||||| ||   | |||||||||||    
9393823 tatcatgttttttgctgttttagtcctacctcctattttcaa-ctccagaaacacagtgaaatgacagttttaagcaattatagacctaccc 9393913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 148; Significance: 6e-78; HSPs: 40)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 227 - 413
Target Start/End: Complemental strand, 22219900 - 22219714
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||    
22219900 taggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcattttt 22219801  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||| |||||||||||||||||||||||||||   ||||||||||||||||||||||| ||||||||||||| ||||    
22219800 gttgcatttttcgttctacctcctattttcaaactccagaaactcagagaaatgacagttttaggcggttttagacctacccctatg 22219714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 230 - 413
Target Start/End: Original strand, 18504920 - 18505103
Alignment:
230 gtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgtt 329  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||| ||||| || |||||||||||||||||||||| ||||||||||||||||||||    
18504920 gtttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcctttttaaaacagaacaaaacggttcttcaattatcatttttgtt 18505019  T
330 gcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
     |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||  ||||||||||||| ||||    
18505020 tcatttttcgtcctacctcctattttcaaactctagaaatgtagagaaatgacagttttaggcgattttagacctacccctatg 18505103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 226 - 413
Target Start/End: Complemental strand, 23075676 - 23075489
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    ||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||    
23075676 ataggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcatgcccttttaaaacagaacaaaacggtccttcaattatcatttt 23075577  T
326 tgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||| |||||||||||||| |||||||| ||||| ||||||||||||||||||||| | ||||||||||||||||||    
23075576 tgttgcatttttcgttctacctcctatttttaaactccaaaaatgcagagaaatgacagttttaggcagttttagacctacccttatg 23075489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 227 - 413
Target Start/End: Complemental strand, 11445534 - 11445348
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||    
11445534 taggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcctttttaaaacagaacaaaacggtccttcaattatcattttt 11445435  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||| |||||||| |||| ||||    
11445434 gttgcatttttcgtcctacctcctattttcaaactctagaaacgcagagaaatgacagttttaggcggttttagacccacccctatg 11445348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 227 - 401
Target Start/End: Original strand, 12935155 - 12935329
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||    
12935155 taggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcattttt 12935254  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttaga 401  Q
    |||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||| ||||||    
12935255 gttgcatttttcgtcctacctcctattttcaaactccataaacgcagagaaatgacagttttaggcggttttaga 12935329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 231 - 390
Target Start/End: Original strand, 10899941 - 10900100
Alignment:
231 tttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttg 330  Q
    ||||||||||||||||||| |||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||    
10899941 tttaattacacttttggtcatcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcatttttgttg 10900040  T
331 catttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||    
10900041 catttttcgtcctacctcctattttcaaactccagaaacgcagagaaatgacagttttag 10900100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 219 - 413
Target Start/End: Complemental strand, 18257692 - 18257498
Alignment:
219 atataaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaatta 318  Q
    ||||||||| || ||||||| ||||||||||||||||| ||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||    
18257692 atataaaattggcttaattatacttttggtcctcgtgttttgacctactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaatta 18257593  T
319 tcatttttgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    | ||||||||| |||||||||||||||||| ||||||| ||||||| | | ||||||||||||||||||||||||| ||||||||||||| ||||    
18257592 ttatttttgttacatttttcgtcctacctcatattttccaactccatacacgtagagaaatgacagttttaggcggttttagacctacccctatg 18257498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 232 - 413
Target Start/End: Complemental strand, 20741646 - 20741462
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcat---ttttgt 328  Q
    ||||||||||| ||||||||||||| |||||||||||||||||||  |||| |||||||||||||||||||||||||||||||||||||||   |||| |    
20741646 ttaattacactcttggtcctcgtgttttggcctactcacgaaactgatcctgcccttttaaaacagaacaaaacggtccttcaattatcatttttttttt 20741547  T
329 tgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||| ||||||||||||| ||||    
20741546 tgcatttttcgtcctacctcctattttcaaactccagaaacgcagagaaatgacaattttaggcggttttagacctacccctatg 20741462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 232 - 413
Target Start/End: Original strand, 31470318 - 31470499
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||| ||||||||| ||||||||||||||||||| ||| | | |||||||||||||||||||| ||| ||||||||| |||||||||||    
31470318 ttaattacacttttgatcctcgtgttttggcctactcacgaaactggtcatgctcttttaaaacagaacaaaacagtcattcaattattatttttgttgc 31470417  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||  ||||||||||||| ||||    
31470418 atttttcgtcctacctcctattttcaaactccagaaacgcagagaaatggcagttttaggcgattttagacctacccctatg 31470499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 227 - 413
Target Start/End: Original strand, 2319670 - 2319855
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||| ||||||||||||||| ||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||    
2319670 taggcttaattacatttttggtcctcgtgttttggcctactcacgaaactggtcatgcccttttaaaacagaacaaaacggtccttcaattatcattttt 2319769  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    |||||||||||||||||||| || ||||| |  ||||||||| | |||||||||| |||||||||||| ||||||||||||| ||||    
2319770 gttgcatttttcgtcctaccccccatttt-attctccagaaacgcagagaaatgatagttttaggcggttttagacctacccctatg 2319855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 232 - 408
Target Start/End: Original strand, 15827641 - 15827818
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaa--acggtccttcaattatcatttttgtt 329  Q
    ||||||||||||||||||||||||| ||||| ||||||||||||| || ||  |||||||||||| ||||||  |||||||||||| |||||||||||||    
15827641 ttaattacacttttggtcctcgtgttttggcttactcacgaaactggttctgtccttttaaaacataacaaattacggtccttcaactatcatttttgtt 15827740  T
330 gcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctaccc 408  Q
    ||||||||||||||||||||||||||||||||||||||| | ||| |||||||| |||||||||| ||||||| |||||    
15827741 gcatttttcgtcctacctcctattttcaaactccagaaacgcagaaaaatgaca-ttttaggcggttttagacttaccc 15827818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 232 - 392
Target Start/End: Original strand, 11276593 - 11276753
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||| ||| |||| ||||| |||| ||||||| ||||||  |||||||||||||||||||||||||| |||||||||||| ||||||||||| |    
11276593 ttaattacacgtttagtccgcgtgttttggtctactcatgaaactgatcctacccttttaaaacagaacaaaatggtccttcaattgtcatttttgtttc 11276692  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggc 392  Q
    ||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||    
11276693 atttttcgtcctacctcctattttcaaactccaaaaacgcagagaaatgacagttttaggc 11276753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 226 - 390
Target Start/End: Original strand, 18257134 - 18257297
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    ||||| ||||||||||||||||||||||||| ||||| ||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||    
18257134 ataggcttaattacacttttggtcctcgtgttttggcatactcacgaaactggtcctgcccttttaaaacagaacaaaacggtccttcaattatcatttt 18257233  T
326 tgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||| |||| || ||||| |  ||||| ||| | |||||||||||||||||||    
18257234 tgttgcatttttcgtcataccccccatttt-attctccaaaaacgcagagaaatgacagttttag 18257297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 227 - 390
Target Start/End: Original strand, 20741098 - 20741260
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||| ||||||||||    
20741098 taggcttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaatggtccttcaaatatcattttt 20741197  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
20741198 gttgcatttttcgtcctaccccccatttt-attctccaaaaacgcagagaaatgacagttttag 20741260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 232 - 390
Target Start/End: Complemental strand, 10900472 - 10900315
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||| | ||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||    
10900472 ttaattacacttttggtcctcgtattttggcctactcacgaaactggtcatgcccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 10900373  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
10900372 atttttcgtcctaccccccatttt-attctccaaaaacgcagagaaatgacagttttag 10900315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 232 - 390
Target Start/End: Complemental strand, 11277124 - 11276967
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||| ||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||||||||    
11277124 ttaattacacttttggtcctcgtgttttggcttactcacgaaactggtcctgcccttttaaaacagaacaaaacggttcttcaattatcatttttgttgc 11277025  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
11277024 atttttcgtcctaccccccatttt-attctccaaaaacgaagagaaatgacagttttag 11276967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 232 - 390
Target Start/End: Complemental strand, 15828183 - 15828026
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||    
15828183 ttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcatacccttttaaaacaaaacaaaacggtccttcaattatcatttttgttgc 15828084  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  ||||| ||| | |||||||| ||||||||||    
15828083 atttttcgtcctaccccccatttt-attctccaaaaacgcagagaaataacagttttag 15828026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 232 - 390
Target Start/End: Complemental strand, 31470858 - 31470701
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||||||||| |||| || |||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||||||||    
31470858 ttaattacacttttggtccttgtgttttagcctactcacgaaactggttctgcccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 31470759  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    ||||||||||||||| || ||||| |  ||||| ||| | |||||||||||| ||||||    
31470758 atttttcgtcctaccccccatttt-attctccaaaaacgcagagaaatgacaattttag 31470701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 230 - 346
Target Start/End: Complemental strand, 2322762 - 2322646
Alignment:
230 gtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgtt 329  Q
    |||||||||||||||||||| |||||| |||| |||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||    
2322762 gtttaattacacttttggtcttcgtgttttggtctactcacgaaactagtcttgcctttttaaaacagaacaaaacggtccttcaattatcatttttgtt 2322663  T
330 gcatttttcgtcctacc 346  Q
    |||||||||||||||||    
2322662 gcatttttcgtcctacc 2322646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 226 - 390
Target Start/End: Complemental strand, 12935705 - 12935542
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttt 325  Q
    ||||| ||||||||||||||||||||||||| ||||| ||||||||||||| ||||| || || ||||||||||||||||||||||||||||||||||||    
12935705 ataggcttaattacacttttggtcctcgtgttttggcgtactcacgaaactggtcctgcctttataaaacagaacaaaacggtccttcaattatcatttt 12935606  T
326 tgttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||| |||||||||||||||| || ||||| |  ||||| |||   |||||||||||||||||||    
12935605 tgttacatttttcgtcctaccccccatttt-attctccataaacacagagaaatgacagttttag 12935542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 227 - 346
Target Start/End: Original strand, 11444985 - 11445104
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| |||||||||||||||| || ||||| ||| |||||||||||| |||| |||||||||||||||||||||    
11444985 taggcttaattacacttttggtcctcgtgttttggcctactcacgaagctggtcctgcccctttaaaacagaataaaatggtccttcaattatcattttt 11445084  T
327 gttgcatttttcgtcctacc 346  Q
    ||||||||||||||||||||    
11445085 gttgcatttttcgtcctacc 11445104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 227 - 390
Target Start/End: Original strand, 28472635 - 28472796
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| |||||| |||||||||| | ||||| || |||||||||||||||||| |||| ||||||||||||||||    
28472635 taggcttaattacacttttggtcctcgtgttttggccaactcacgaaagtggtcctgccattttaaaacagaacaaaatggtcattcaattatcattttt 28472734  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
28472735 gttgcatttttcgtcctacc-cccatttt-attctccaaaaacgcagagaaatgacagttttag 28472796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 227 - 390
Target Start/End: Original strand, 29859824 - 29859985
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||||||||||||||||||||| |||||| |||||||||| | ||||| || |||||||||||||||||| |||| ||||||||||||||||    
29859824 taggcttaattacacttttggtcctcgtgttttggccaactcacgaaagtggtcctgccattttaaaacagaacaaaatggtcattcaattatcattttt 29859923  T
327 gttgcatttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttag 390  Q
    |||||||||||||||||||| || ||||| |  ||||| ||| | |||||||||||||||||||    
29859924 gttgcatttttcgtcctacc-cccatttt-attctccaaaaacgcagagaaatgacagttttag 29859985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 232 - 413
Target Start/End: Complemental strand, 4811798 - 4811618
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||| ||||||| ||||||||| |||||||||||| ||||||  || | |  |||||||||||||||||||||||||||||||||||||||||||||    
4811798 ttaattatacttttgatcctcgtgttttggcctactcatgaaactgatcatgcatttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 4811699  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagttttaggcggntttagacctacccttatg 413  Q
    ||||||| || |||||||||||||||||| ||| ||| | ||| ||||| || |||||||  | ||||||||||||| ||||    
4811698 atttttcatcatacctcctattttcaaaccccataaacgcaga-aaatggcaattttaggtagttttagacctacccctatg 4811618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 232 - 389
Target Start/End: Complemental strand, 18505461 - 18505305
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||| ||||||||||||||||| |||| ||||||||||||||  |||| ||||||||||||| |||||||| |||||||||||||||||||||||||    
18505461 ttaattatacttttggtcctcgtgttttggtctactcacgaaactgatcctgcccttttaaaacataacaaaacagtccttcaattatcatttttgttgc 18505362  T
332 atttttcgtcctacctcctattttcaaactccagaaatgtagagaaatgacagtttta 389  Q
    ||||||||||||||| || ||||| |  |||||  || | ||||||||||||||||||    
18505361 atttttcgtcctaccccccatttt-attctccaacaacgaagagaaatgacagtttta 18505305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 219 - 355
Target Start/End: Complemental strand, 1149987 - 1149851
Alignment:
219 atataaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaatta 318  Q
    ||||||| | || ||||||||||||||||||||||||| || ||||||||| |||||| ||| | ||||||||||| |||||||||||||||||||||||    
1149987 atataaatttggcttaattacacttttggtcctcgtgttttagcctactcatgaaactggtcatgcccttttaaaatagaacaaaacggtccttcaatta 1149888  T
319 tcatttttgttgcatttttcgtcctacctcctatttt 355  Q
     ||||||||||||||||||||||||||| || |||||    
1149887 ccatttttgttgcatttttcgtcctaccccccatttt 1149851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 232 - 326
Target Start/End: Original strand, 23074002 - 23074096
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||    
23074002 ttaattacacttttggtcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaatagaacaaaacggtccttcaattatcattttt 23074096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 232 - 355
Target Start/End: Original strand, 29033437 - 29033560
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    ||||||||||||||||||||||| | ||||||| ||||||||| | ||||| |||||||||||||||||||||| |||||||| ||||||||||||||||    
29033437 ttaattacacttttggtcctcgtattttggcctgctcacgaaattggtcctgcccttttaaaacagaacaaaactgtccttcagttatcatttttgttgc 29033536  T
332 atttttcgtcctacctcctatttt 355  Q
    |  |||| ||||||| || |||||    
29033537 acatttcatcctaccccccatttt 29033560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 222 - 355
Target Start/End: Original strand, 4811365 - 4811498
Alignment:
222 taaaataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatca 321  Q
    |||||| || |||||||||||||||||||  || | |||| |||||||||||||| ||| | ||||||||||| |||| |||||||||||||||||||||    
4811365 taaaattggcttaattacacttttggtcccagtattttggtctactcacgaaactggtcatgcccttttaaaatagaataaaacggtccttcaattatca 4811464  T
322 tttttgttgcatttttcgtcctacctcctatttt 355  Q
    |||||||| ||||||||||| |||| || |||||    
4811465 tttttgtttcatttttcgtcttaccccccatttt 4811498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 226 - 317
Target Start/End: Original strand, 1149462 - 1149553
Alignment:
226 ataggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaatt 317  Q
    ||||| ||||||||||||||| ||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||    
1149462 ataggcttaattacacttttgatcctcgtgttttggcctactcacgaaactggtcctgcccttttaaaacagaacaaaatggtccttcaatt 1149553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 228 - 355
Target Start/End: Complemental strand, 3835272 - 3835145
Alignment:
228 aggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttg 327  Q
    |||||||||||||||||||||||  |||| ||| ||||||||||||| | ||||| ||  |||||||||||||||||  |||||| ||||||||||||||    
3835272 aggtttaattacacttttggtccatgtgttttgacctactcacgaaaatggtcctgcctctttaaaacagaacaaaattgtcctttaattatcatttttg 3835173  T
328 ttgcatttttcgtcctacctcctatttt 355  Q
    | ||||||||||||||||| || |||||    
3835172 tggcatttttcgtcctaccccccatttt 3835145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 232 - 342
Target Start/End: Complemental strand, 29035179 - 29035069
Alignment:
232 ttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcatttttgttgc 331  Q
    |||||||||||||| |||||||||| || |||||||||||||| | ||  | |||||||||||||||||||||  |||||| | ||||||||||||||||    
29035179 ttaattacacttttcgtcctcgtgttttagcctactcacgaaattggttatgcccttttaaaacagaacaaaattgtcctttagttatcatttttgttgc 29035080  T
332 atttttcgtcc 342  Q
    |||||||||||    
29035079 atttttcgtcc 29035069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 227 - 346
Target Start/End: Original strand, 18296143 - 18296262
Alignment:
227 taggtttaattacacttttggtcctcgtgtattggcctactcacgaaactagtcctacccttttaaaacagaacaaaacggtccttcaattatcattttt 326  Q
    |||| ||||||| | |||| |||||||||| ||| | ||||||| ||| |  |  | |||||||||||||||||||||| |||||||| |||||||||||    
18296143 taggcttaattataattttagtcctcgtgttttgacttactcacaaaattgatattgcccttttaaaacagaacaaaaccgtccttcatttatcattttt 18296242  T
327 gttgcatttttcgtcctacc 346  Q
    ||||||||||||||||||||    
18296243 gttgcatttttcgtcctacc 18296262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 322 - 392
Target Start/End: Complemental strand, 35163639 - 35163570
Alignment:
322 tttttgttgc