View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D682-LTR4-TNT-insertion-1 (Length: 205)

Name: D682-LTR4-TNT-insertion-1
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] D682-LTR4-TNT-insertion-1
[»] chr1 (1 HSPs)
chr1 (6-197)||(49475420-49475611)

Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 6 - 197
Target Start/End: Original strand, 49475420 - 49475611
6 caaaacataccggaacagcccaaaaaggaatggtgttatctttcagtgggtatctaaggtccgtcatcatatcctctccaacaaaacggtgaaatggctc 105  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
49475420 caaaacataccggaacagcccaaaaaggaatagtgttatctttcagtgggtatctaaggtccgtcatcatatcttctccaacaaaacggtgaaatggctc 49475519  T
106 tattatattcaagacagcatcaattaccacaagaagcaaaagaatcaaccagtcatgcatatgtatccttgcgactctagctccatgtgatc 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
49475520 tattatattcaagacagcatcaattaccacaagaagcaaaagaatcaaccagtcatgcatatgtatccttgcaactctagctccatgtgatc 49475611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC