View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D682-LTR4-TNT-insertion-10 (Length: 205)

Name: D682-LTR4-TNT-insertion-10
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D682-LTR4-TNT-insertion-10
D682-LTR4-TNT-insertion-10
[»] chr3 (1 HSPs)
chr3 (8-197)||(50580381-50580569)
[»] chr1 (1 HSPs)
chr1 (8-197)||(1059225-1059413)


Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 8 - 197
Target Start/End: Original strand, 50580381 - 50580569
Alignment:
8 gtattcatgcatgacccaattactnntctctcctcgaggagctntgccttngtaaaagaccaatgtcttnttcattccaaccaactccgatgtaacactg 107  Q
    ||||||||||||||||||||||||  ||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||||||||||||||||    
50580381 gtattcatgcatgacccaattacttttctctcctcgaggagctctgcctttgtaaaagaccaatgtcttcttcattccaaccaactccgatgtaacactg 50580480  T
108 tcgaagatttctcngtcnttccctgtggtcntccagtatccggngtntgttgctcgattcgttctcacagccggntggatatttacgatc 197  Q
    ||||||||||||| ||| |||||||||||| |||||||||||| || |||||||||||||||||||||| |||| |||||||||||||||    
50580481 tcgaagatttctctgtctttccctgtggtcttccagtatccggtgtttgttgctcgattcgttctcaca-ccggttggatatttacgatc 50580569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 8 - 197
Target Start/End: Complemental strand, 1059413 - 1059225
Alignment:
8 gtattcatgcatgacccaattactnntctctcctcgaggagctntgccttngtaaaagaccaatgtcttnttcattccaaccaactccgatgtaacactg 107  Q
    |||||||||||| ||||| ||  |  ||||||||| ||||||    |||| |||||| ||||| ||||| ||||| ||||| || || ||||||||||||    
1059413 gtattcatgcataacccagttggttttctctcctctaggagcccgacctttgtaaaaaaccaaagtcttcttcataccaactaattctgatgtaacactg 1059314  T
108 tcgaagatttctcngtcnttccctgtggtcntccagtatccggngtntgttgctcgattcgttctcacagccggntggatatttacgatc 197  Q
    | ||| || ||   ||| |||||||||||  |||| ||||| | || |||||||| ||| ||||||||| || | |||||||||||||||    
1059313 ttgaaaatctccttgtctttccctgtggttttccaatatccagtgtttgttgctctattagttctcaca-cctgttggatatttacgatc 1059225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC