View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D682-LTR4-TNT-insertion-10 (Length: 205)

Name: D682-LTR4-TNT-insertion-10
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] D682-LTR4-TNT-insertion-10
[»] chr3 (1 HSPs)
chr3 (8-197)||(50580381-50580569)
[»] chr1 (1 HSPs)
chr1 (8-197)||(1059225-1059413)

Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 8 - 197
Target Start/End: Original strand, 50580381 - 50580569
8 gtattcatgcatgacccaattactnntctctcctcgaggagctntgccttngtaaaagaccaatgtcttnttcattccaaccaactccgatgtaacactg 107  Q
    ||||||||||||||||||||||||  ||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||||||||||||||||    
50580381 gtattcatgcatgacccaattacttttctctcctcgaggagctctgcctttgtaaaagaccaatgtcttcttcattccaaccaactccgatgtaacactg 50580480  T
108 tcgaagatttctcngtcnttccctgtggtcntccagtatccggngtntgttgctcgattcgttctcacagccggntggatatttacgatc 197  Q
    ||||||||||||| ||| |||||||||||| |||||||||||| || |||||||||||||||||||||| |||| |||||||||||||||    
50580481 tcgaagatttctctgtctttccctgtggtcttccagtatccggtgtttgttgctcgattcgttctcaca-ccggttggatatttacgatc 50580569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 8 - 197
Target Start/End: Complemental strand, 1059413 - 1059225
8 gtattcatgcatgacccaattactnntctctcctcgaggagctntgccttngtaaaagaccaatgtcttnttcattccaaccaactccgatgtaacactg 107  Q
    |||||||||||| ||||| ||  |  ||||||||| ||||||    |||| |||||| ||||| ||||| ||||| ||||| || || ||||||||||||    
1059413 gtattcatgcataacccagttggttttctctcctctaggagcccgacctttgtaaaaaaccaaagtcttcttcataccaactaattctgatgtaacactg 1059314  T
108 tcgaagatttctcngtcnttccctgtggtcntccagtatccggngtntgttgctcgattcgttctcacagccggntggatatttacgatc 197  Q
    | ||| || ||   ||| |||||||||||  |||| ||||| | || |||||||| ||| ||||||||| || | |||||||||||||||    
1059313 ttgaaaatctccttgtctttccctgtggttttccaatatccagtgtttgttgctctattagttctcaca-cctgttggatatttacgatc 1059225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 93594 times since January 2019
Visitors: 2365