View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D682-LTR4-TNT-insertion-14 (Length: 210)

Name: D682-LTR4-TNT-insertion-14
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] D682-LTR4-TNT-insertion-14
[»] scaffold0179 (1 HSPs)
scaffold0179 (8-202)||(3706-3900)

Alignment Details
Target: scaffold0179 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: scaffold0179

Target: scaffold0179; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 8 - 202
Target Start/End: Complemental strand, 3900 - 3706
8 ctagccaccaaaataagtgaaacaatgacacgaaataaaagattcggctgtgaaaataatgaaagataacttcaaaacgcaccaaataaaatatgcatct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3900 ctagccaccaaaataagtgaaacaatgacacgaaataaaagattcagctgtgaaaataatgaaagataacttcaaaacgcaccaaataaaatatgcatct 3801  T
108 gggtatatgtcacctgtgtaaaaccttcttttctcttttgtccaatttttgccnnnnnnnccgtagcttctttgtgataccaatgactggtgatc 202  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||    
3800 gggtatttgtcacctgtgtaaaaccttcttttctcttttgtccaatttttgcctttttttccgtagcttctttgtgataccaatgactggtgatc 3706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 77529 times since January 2019
Visitors: 2275