View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D682-LTR4-TNT-insertion-16 (Length: 255)

Name: D682-LTR4-TNT-insertion-16
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D682-LTR4-TNT-insertion-16
D682-LTR4-TNT-insertion-16
[»] chr5 (1 HSPs)
chr5 (8-248)||(28267342-28267582)


Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 28267582 - 28267342
Alignment:
8 gttataacagacaaagcgactgaaaacgcatcagtgtgtagctatataaggaaagtgatgaaactgcttttagttggtggagtgaaacccagagtagaaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||    
28267582 gttataacagacaaagcgactgaaaacgcatcagtgtgtagctatataaggaaagtgatgaaactgcttttggttggtggagtgaaacccagagaagaaa 28267483  T
108 accactagtggttttaagagggatgccacgtggaccaataagggattgacatttcggaaaggatattcgtatgttgaagttcgtgtcaatcaccgttgca 207  Q
    ||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||  ||||||||||||    
28267482 accactagtggtttttagagggataccacgtggaccaataagagattgacatttcggaaaggatattcgtatgttgaagttcgtgttgatcaccgttgca 28267383  T
208 ttgctgacgcgtggtaatgcgattacgcaagccgtagatcg 248  Q
    ||||||||||||||||||||| |||||||||||||||||||    
28267382 ttgctgacgcgtggtaatgcgtttacgcaagccgtagatcg 28267342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC