View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D682-LTR4-TNT-insertion-2 (Length: 134)

Name: D682-LTR4-TNT-insertion-2
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D682-LTR4-TNT-insertion-2
D682-LTR4-TNT-insertion-2
[»] scaffold0006 (2 HSPs)
scaffold0006 (7-122)||(172245-172365)
scaffold0006 (7-122)||(178787-178907)
[»] chr7 (1 HSPs)
chr7 (7-122)||(6926566-6926686)
[»] chr4 (1 HSPs)
chr4 (7-122)||(501823-501943)
[»] chr1 (3 HSPs)
chr1 (7-122)||(13593082-13593202)
chr1 (7-122)||(13674631-13674751)
chr1 (7-122)||(20482917-20483037)


Alignment Details
Target: scaffold0006 (Bit Score: 75; Significance: 6e-35; HSPs: 2)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 7 - 122
Target Start/End: Original strand, 172245 - 172365
Alignment:
7 agatccaaggattcatcttatatgcacaataaaatttgcttaattttgaaaagaaccaaaatcccgggaataaggaat------ttcggtctagaagtct 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||      ||||||||||||||||    
172245 agatccaaggattcatcttatatgcacaatataatttgcttaattttgaaaagaaccaaaat-ccgggaataaggaatttatccttcggtctagaagtct 172343  T
101 ttttcccttttatcttcattcc 122  Q
    |||||| |||||  ||||||||    
172344 ttttcctttttacattcattcc 172365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006; HSP #2
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 7 - 122
Target Start/End: Original strand, 178787 - 178907
Alignment:
7 agatccaaggattcatcttatatgcacaataaaatttgcttaattttgaaaagaaccaaaatcccgggaataaggaat------ttcggtctagaagtct 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||      |||||| |||||||||    
178787 agatccaaggattcatcttatatgcacaatataatttgcttaattttgaaaagaaccaaaat-ccgggaataaggaatttattcttcggtttagaagtct 178885  T
101 ttttcccttttatcttcattcc 122  Q
    |||||| |||||  ||||||||    
178886 ttttcctttttacattcattcc 178907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 75; Significance: 6e-35; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 7 - 122
Target Start/End: Complemental strand, 6926686 - 6926566
Alignment:
7 agatccaaggattcatcttatatgcacaataaaatttgcttaattttgaaaagaaccaaaatcccgggaataaggaat------ttcggtctagaagtct 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||      ||||||||||||||||    
6926686 agatccaaggattcatcttatatgcacaatataatttgcttaattttgaaaagaaccaaaat-ccgggaataaggaatttatccttcggtctagaagtct 6926588  T
101 ttttcccttttatcttcattcc 122  Q
    |||||| |||||  ||||||||    
6926587 ttttcctttttacattcattcc 6926566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 75; Significance: 6e-35; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 7 - 122
Target Start/End: Complemental strand, 501943 - 501823
Alignment:
7 agatccaaggattcatcttatatgcacaataaaatttgcttaattttgaaaagaaccaaaatcccgggaataaggaat------ttcggtctagaagtct 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||      ||||||||||||||||    
501943 agatccaaggattcatcttatatgcacaatataatttgcttaattttgaaaagaaccaaaat-ccgggaataaggaatttatccttcggtctagaagtct 501845  T
101 ttttcccttttatcttcattcc 122  Q
    |||||| |||||  ||||||||    
501844 ttttcctttttacattcattcc 501823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 71; Significance: 1e-32; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 7 - 122
Target Start/End: Original strand, 13593082 - 13593202
Alignment:
7 agatccaaggattcatcttatatgcacaataaaatttgcttaattttgaaaagaaccaaaatcccgggaataaggaa------tttcggtctagaagtct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||       |||||| |||||||||    
13593082 agatccaaggattcatcttatatgcacaataaaatttgcttaattttgaaaagaaccaaaat-ccgggaataaggaagttattcttcggtatagaagtct 13593180  T
101 ttttcccttttatcttcattcc 122  Q
    |||||| |||||  ||||||||    
13593181 ttttcctttttacattcattcc 13593202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 7 - 122
Target Start/End: Original strand, 13674631 - 13674751
Alignment:
7 agatccaaggattcatcttatatgcacaataaaatttgcttaattttgaaaagaaccaaaatcccgggaataaggaa------tttcggtctagaagtct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||       |||||| |||||||||    
13674631 agatccaaggattcatcttatatgcacaataaaatttgcttaattttgaaaagaaccaaaat-ccgggaataaggaagttattcttcggtatagaagtct 13674729  T
101 ttttcccttttatcttcattcc 122  Q
    |||||| |||||  ||||||||    
13674730 ttttcctttttacattcattcc 13674751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 7 - 122
Target Start/End: Original strand, 20482917 - 20483037
Alignment:
7 agatccaaggattcatcttatatgcacaataaaatttgcttaattttgaaaagaaccaaaatcccgggaataaggaa------tttcggtctagaagtct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||       |||||| |||||||||    
20482917 agatccaaggattcatcttatatgcacaataaaatttgcttaattttgaaaagaaccaaaat-ccgggaataaggaagttattcttcggtatagaagtct 20483015  T
101 ttttcccttttatcttcattcc 122  Q
    |||||| |||||  ||||||||    
20483016 ttttcctttttacattcattcc 20483037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98184 times since January 2019
Visitors: 2269