View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D682-LTR4-TNT-insertion-5 (Length: 214)

Name: D682-LTR4-TNT-insertion-5
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D682-LTR4-TNT-insertion-5
D682-LTR4-TNT-insertion-5
[»] chr7 (1 HSPs)
chr7 (7-206)||(28488124-28488323)


Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 206
Target Start/End: Original strand, 28488124 - 28488323
Alignment:
7 acttctcatcattcacttttatttagttggtctcctccacaactatatcctcgacataaatctacatttttaagcgtagtggccaaactatcgtcgcatc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    
28488124 acttctcatcattcacttttatttagttggtctcctccacaactatatcctcgacataaatctacatttttaagcgtagtggccaaactattgtcacatc 28488223  T
107 caaattattctcgaccataaccttgttctcaaccttgcttatctcagttatttggctttcttctttttcctttagttgtatcttgagtttattagtgatc 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28488224 caaattattctcgaccataaccttgttctcaaccttgcttatctcagttatttggctttcttctttttcctttagttgtatcttgagtttattagtgatc 28488323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 84041 times since January 2019
Visitors: 2323