View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D682-LTR4-TNT-insertion-8 (Length: 346)

Name: D682-LTR4-TNT-insertion-8
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D682-LTR4-TNT-insertion-8
D682-LTR4-TNT-insertion-8
[»] chr1 (1 HSPs)
chr1 (7-338)||(33999107-33999429)


Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 338
Target Start/End: Original strand, 33999107 - 33999429
Alignment:
7 atccaagtcagtcaaaatctagagacttaaactaatcttgcgtgtaccaaaattcatttaagnnnnnnnnngattaacatatcttataaaaatgtgcaat 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||| ||  |||||||||||||||    
33999107 atccaagtcagtcaaaatctagagacttaaactaatcttgcgtgtaccaaaattcatttaagaaaaaaaaaaattaacatctc--ataaaaatgtgcaat 33999204  T
107 ttcatttcataccctnnnnnnnnngatgtgtgcattgataaaccgtgacacagacacgatgttgtgttccacgttgaaaataaaaaacatcatgcaacta 206  Q
    |||||||||||||||          |||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33999205 ttcatttcataccctaaaaaaattaatgtgtgcatt-------cgtgacacagacacgatgttgtgttccacgttgaaaataaaaaacatcatgcaacta 33999297  T
207 gttgtttgttgcncaagcatgatgtcacaaactacaacaaaattgccatcccttgaaagcgtgactggtccctttccctattcggacnattttgacacta 306  Q
    ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
33999298 gttgtttgttgcaaaagcatgatgtcacaaactacaacaaaattgccatcccttgaaagcgtgactggtccctttccctattcggacaattttgacacta 33999397  T
307 tatagggnccctaatacaccctaactatgatc 338  Q
    ||||||| |||||| |||||||||||||||||    
33999398 tatagggtccctaagacaccctaactatgatc 33999429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC