View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D682-LTR4-TNT-insertion-9 (Length: 249)

Name: D682-LTR4-TNT-insertion-9
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] D682-LTR4-TNT-insertion-9
D682-LTR4-TNT-insertion-9
[»] scaffold0280 (1 HSPs)
scaffold0280 (11-241)||(1723-1953)
[»] scaffold0148 (1 HSPs)
scaffold0148 (126-238)||(26992-27104)


Alignment Details
Target: scaffold0280 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0280
Description:

Target: scaffold0280; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 1723 - 1953
Alignment:
11 attgtcggtgattggacataatgttacggcttgccattggatacacccaaattaagttgttgaaaaattgaagatacaagattgttgttgcttactttcg 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
1723 attgtcggtgattggacataatgttacggcttgccattggatacacccaaattaagttgttgaaaaattgaagatacaagattgttgttgctttctttcg 1822  T
111 atacaacataaaagctcgccactccatttatactttgcattgcaaagacacttgtttcctttactacaggtagaatgtttccaaccatggcaatcaacaa 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||    
1823 atacaacataaaagctcgccactccatttatactttgcattgcaaagacacttgtttcctttactacaggtagaatgtttccaaccatagaaatcaacaa 1922  T
211 agttatcacaaacgggttcggaaggtggatc 241  Q
    |||||||||||||| ||||||||||||||||    
1923 agttatcacaaacgagttcggaaggtggatc 1953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0148 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0148
Description:

Target: scaffold0148; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 126 - 238
Target Start/End: Original strand, 26992 - 27104
Alignment:
126 tcgccactccatttatactttgcattgcaaagacacttgtttcctttactacaggtagaatgtttccaaccatggcaatcaacaaagttatcacaaacgg 225  Q
    |||||| |||| ||||| |||||||||||||||||| | |||||||||||||| |||||||| ||||| ||||||||||||||| |||||| ||| | ||    
26992 tcgccattccagttatagtttgcattgcaaagacacctctttcctttactacaagtagaatggttccagccatggcaatcaacagagttattacagatgg 27091  T
226 gttcggaaggtgg 238  Q
    |||||||||||||    
27092 gttcggaaggtgg 27104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98471 times since January 2019
Visitors: 2275