View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: D682-LTR4-TNT-insertion-9 (Length: 249)

Name: D682-LTR4-TNT-insertion-9
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] D682-LTR4-TNT-insertion-9
[»] scaffold0280 (1 HSPs)
scaffold0280 (11-241)||(1723-1953)
[»] scaffold0148 (1 HSPs)
scaffold0148 (126-238)||(26992-27104)

Alignment Details
Target: scaffold0280 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0280

Target: scaffold0280; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 1723 - 1953
11 attgtcggtgattggacataatgttacggcttgccattggatacacccaaattaagttgttgaaaaattgaagatacaagattgttgttgcttactttcg 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
1723 attgtcggtgattggacataatgttacggcttgccattggatacacccaaattaagttgttgaaaaattgaagatacaagattgttgttgctttctttcg 1822  T
111 atacaacataaaagctcgccactccatttatactttgcattgcaaagacacttgtttcctttactacaggtagaatgtttccaaccatggcaatcaacaa 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||    
1823 atacaacataaaagctcgccactccatttatactttgcattgcaaagacacttgtttcctttactacaggtagaatgtttccaaccatagaaatcaacaa 1922  T
211 agttatcacaaacgggttcggaaggtggatc 241  Q
    |||||||||||||| ||||||||||||||||    
1923 agttatcacaaacgagttcggaaggtggatc 1953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0148 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0148

Target: scaffold0148; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 126 - 238
Target Start/End: Original strand, 26992 - 27104
126 tcgccactccatttatactttgcattgcaaagacacttgtttcctttactacaggtagaatgtttccaaccatggcaatcaacaaagttatcacaaacgg 225  Q
    |||||| |||| ||||| |||||||||||||||||| | |||||||||||||| |||||||| ||||| ||||||||||||||| |||||| ||| | ||    
26992 tcgccattccagttatagtttgcattgcaaagacacctctttcctttactacaagtagaatggttccagccatggcaatcaacagagttattacagatgg 27091  T
226 gttcggaaggtgg 238  Q
27092 gttcggaaggtgg 27104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC