View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9045J-LTR4-TNT-insertion-2 (Length: 265)

Name: F9045J-LTR4-TNT-insertion-2
Description: F9045J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9045J-LTR4-TNT-insertion-2
F9045J-LTR4-TNT-insertion-2
[»] chr7 (2 HSPs)
chr7 (7-255)||(35630091-35630339)
chr7 (7-255)||(35636542-35636790)
[»] chr3 (6 HSPs)
chr3 (7-248)||(10298519-10298760)
chr3 (7-248)||(10318951-10319192)
chr3 (7-241)||(10336073-10336307)
chr3 (10-237)||(10337922-10338153)
chr3 (174-237)||(10300521-10300584)
chr3 (197-241)||(10318829-10318873)


Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 7 - 255
Target Start/End: Original strand, 35630091 - 35630339
Alignment:
7 accaattacagcacgtgaatctccaagatttgcaacatgtagcgtccctttccatatgattccagcaagacagcatgaaccaacttttccaagatttcga 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35630091 accaattacagcacgtgaatctccaagatttgcaacatgtagcgtccctttccatatgattccagcaagacagcatgaaccaacttttccaagatttcga 35630190  T
107 tttatcatataattcctttttacagaatccaaaaaactcgcttcagtagcagaaacagcatccctcagggtagcttcagttattttattctcattctcat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35630191 tttatcatataattcctttttacagaatccaaaaaactcgcttcagtagcagaaacagcatccctcagggtagcttcagttattttattctcattctcat 35630290  T
207 tagtaagccctataatgtaaccacataacataaaagcaaaattccatta 255  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
35630291 tagtaagccctataatgtaaccacataacataaaagcaaaattccatta 35630339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 7 - 255
Target Start/End: Original strand, 35636542 - 35636790
Alignment:
7 accaattacagcacgtgaatctccaagatttgcaacatgtagcgtccctttccatatgattccagcaagacagcatgaaccaacttttccaagatttcga 106  Q
    ||||||||||||||| |||||||||||||| |||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||        
35636542 accaattacagcacgcgaatctccaagattcgcaacatgtagcgtctttttccatataattccagcaagacagcatgaaccaacttttccaagattattt 35636641  T
107 tttatcatataattcctttttacagaatccaaaaaactcgcttcagtagcagaaacagcatccctcagggtagcttcagttattttattctcattctcat 206  Q
    |||  | |||||||  ||| |||| | ||||||||||  |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |      
35636642 ttttgcctataatttttttctacatattccaaaaaacctgcttcagtagcagaaacagcatccctcagggtaggttcagttattttattctcattcgctc 35636741  T
207 tagtaagccctataatgtaaccacataacataaaagcaaaattccatta 255  Q
        |  ||||| ||||||||||||||||||||||  ||||||||||||    
35636742 gcacagcccctaaaatgtaaccacataacataaaataaaaattccatta 35636790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 7 - 248
Target Start/End: Complemental strand, 10298760 - 10298519
Alignment:
7 accaattacagcacgtgaatctccaagatttgcaacatgtagcgtccctttccatatgattccagcaagacagcatgaaccaacttttccaagatttcga 106  Q
    |||||||||| | || |||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| | |||||||||| |     
10298760 accaattacaacgcgcgaatctccaagatttgcaacatgtagtgtctctttccatataattccagcaagacagcatgaaccaacatatccaagatttggc 10298661  T
107 tttatcatataattcctttttacagaatccaaaaaactcgcttcagtagcagaaacagcatccctcagggtagcttcagttattttattctcattctcat 206  Q
    |    |||||||||| ||||| || |||||||||||| | |||||||||||||||||||||  |||||||||||||||||||| | ||||||||| ||||    
10298660 tgatgcatataattcatttttgcaaaatccaaaaaaccctcttcagtagcagaaacagcatttctcagggtagcttcagttatatcattctcattatcat 10298561  T
207 tagtaagccctataatgtaaccacataacataaaagcaaaat 248  Q
    ||| || ||||||||||||| ||||||||||||||| |||||    
10298560 tagcaaaccctataatgtaaacacataacataaaagaaaaat 10298519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 7 - 248
Target Start/End: Complemental strand, 10319192 - 10318951
Alignment:
7 accaattacagcacgtgaatctccaagatttgcaacatgtagcgtccctttccatatgattccagcaagacagcatgaaccaacttttccaagatttcga 106  Q
    |||||||||| | || |||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| | |||||||||| |     
10319192 accaattacaacccgcgaatctccaagatttgcaacatgtagtgtctctttccatataattccagcaagacagcatgaaccaacatatccaagatttggc 10319093  T
107 tttatcatataattcctttttacagaatccaaaaaactcgcttcagtagcagaaacagcatccctcagggtagcttcagttattttattctcattctcat 206  Q
    |    |||||||||| ||||| || |||||||||||| | |||||||||||||||||||||  |||||||||||||||||||| | ||||||||| ||||    
10319092 tgatgcatataattcatttttgcaaaatccaaaaaaccctcttcagtagcagaaacagcatttctcagggtagcttcagttatatcattctcattatcat 10318993  T
207 tagtaagccctataatgtaaccacataacataaaagcaaaat 248  Q
    ||| || ||||||||||||| ||||||||||||||| |||||    
10318992 tagcaaaccctataatgtaaacacataacataaaagaaaaat 10318951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 7 - 241
Target Start/End: Complemental strand, 10336307 - 10336073
Alignment:
7 accaattacagcacgtgaatctccaagatttgcaacatgtagcgtccctttccatatgattccagcaagacagcatgaaccaacttttccaagatttcga 106  Q
    |||||||||| | || |||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| | |||||||||| |     
10336307 accaattacaacccgcgaatctccaagatttgcaacatgtagtgtctctttccatataattccagcaagacagcatgaaccaacatatccaagatttggc 10336208  T
107 tttatcatataattcctttttacagaatccaaaaaactcgcttcagtagcagaaacagcatccctcagggtagcttcagttattttattctcattctcat 206  Q
    |    |||||||||| ||||| || |||||||||||| | |||||||||||||||||||||  |||||||||||||||||||| | ||||||||| ||||    
10336207 tgatgcatataattcatttttgcaaaatccaaaaaaccctcttcagtagcagaaacagcatttctcagggtagcttcagttatatcattctcattatcat 10336108  T
207 tagtaagccctataatgtaaccacataacataaaa 241  Q
    ||| || ||||||||||||| ||||||||||||||    
10336107 tagcaaaccctataatgtaaacacataacataaaa 10336073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 10 - 237
Target Start/End: Complemental strand, 10338153 - 10337922
Alignment:
10 aattacagcacgtgaatctccaagatttgcaacatgtagcgtccctttccatatgattccagcaagacagcatgaaccaacttttccaag-----atttc 104  Q
    |||||||||||| |||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||  | ||||||     | ||     
10338153 aattacagcacgcgaatctccaagattcgcaatatgtagcgtccctttccatataattccagcaagacagcatgaaccaa-atatccaagaatataattg 10338055  T
105 gatttatcatataattcctttttacagaatccaaaaaactcgcttcagtagcagaaacagcatccctcagggtagcttcagttattttattctcattctc 204  Q
    | | |   ||||||||| |||||||| |||||||| ||| | ||||||||||| |||| |||| ||||||||||||||||||||| | ||||| ||| ||    
10338054 gctctgcaatataattcgtttttacaaaatccaaacaaccctcttcagtagcaaaaactgcattcctcagggtagcttcagttatatcattctaattatc 10337955  T
205 attagtaagccctataatgtaaccacataacat 237  Q
     |||| | ||||||||||| |||||||||||||    
10337954 tttagcatgccctataatggaaccacataacat 10337922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 174 - 237
Target Start/End: Complemental strand, 10300584 - 10300521
Alignment:
174 gggtagcttcagttattttattctcattctcattagtaagccctataatgtaaccacataacat 237  Q
    |||||||||||||||| | ||||| ||| || |||| | ||||||||||| |||||||||||||    
10300584 gggtagcttcagttatatcattctaattatctttagcatgccctataatggaaccacataacat 10300521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 197 - 241
Target Start/End: Complemental strand, 10318873 - 10318829
Alignment:
197 tcattctcattagtaagccctataatgtaaccacataacataaaa 241  Q
    ||||| ||||||| || ||||||||||||| ||||||||||||||    
10318873 tcattatcattagcaaaccctataatgtaaacacataacataaaa 10318829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC