View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9045J-LTR4-TNT-insertion-3 (Length: 205)

Name: F9045J-LTR4-TNT-insertion-3
Description: F9045J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9045J-LTR4-TNT-insertion-3
F9045J-LTR4-TNT-insertion-3
[»] chr7 (4 HSPs)
chr7 (10-195)||(12416093-12416278)
chr7 (97-195)||(18122360-18122458)
chr7 (97-195)||(18060550-18060648)
chr7 (97-195)||(18090603-18090701)
[»] scaffold0108 (1 HSPs)
scaffold0108 (33-193)||(17032-17192)


Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 10 - 195
Target Start/End: Complemental strand, 12416278 - 12416093
Alignment:
10 tcatataattaaaatgtagttcgagaaatattagcttacctgtagttgcagctaatgcatcaaaattgtcaatatagtacattttgcttctatttgattc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12416278 tcatataattaaaatgtagttcgagaaatattagcttacctgtagttgcagctaatgcatcaaaattgtcaatatagtacattttgcttctatttgattc 12416179  T
110 atgtctagcaaagatagacatataataattgactccgataaagtctaaacttcctttgagcatatgtttctcctttttagtgaatt 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12416178 atgtctagcaaagatagacatataataattgactccgataaagtctaaacttcctttgagcatatgtttctcctttttagtgaatt 12416093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 97 - 195
Target Start/End: Original strand, 18122360 - 18122458
Alignment:
97 ttctatttgattcatgtctagcaaagatagacatataataattgactccgataaagtctaaacttcctttgagcatatgtttctcctttttagtgaatt 195  Q
    ||||||||| |||||||||| |||||| ||| | |||||||||||  || |||||||||  ||||||||| | ||| | |||||| |||||||||||||    
18122360 ttctatttggttcatgtctaacaaagagagaaaaataataattgatcccaataaagtctgtacttcctttcaacatttctttctcatttttagtgaatt 18122458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 97 - 195
Target Start/End: Original strand, 18060550 - 18060648
Alignment:
97 ttctatttgattcatgtctagcaaagatagacatataataattgactccgataaagtctaaacttcctttgagcatatgtttctcctttttagtgaatt 195  Q
    ||||||||| |||||||||| |||||  |||  |||||||||| | ||| ||||||||||  |||||||| | ||| | |||||| |||||||||||||    
18060550 ttctatttggttcatgtctaacaaagtgagaagtataataattaattccaataaagtctatgcttcctttcaacatttctttctcatttttagtgaatt 18060648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 97 - 195
Target Start/End: Original strand, 18090603 - 18090701
Alignment:
97 ttctatttgattcatgtctagcaaagatagacatataataattgactccgataaagtctaaacttcctttgagcatatgtttctcctttttagtgaatt 195  Q
    ||||||||| |||||||||| || ||  |||  |||||||||||| ||| ||||||||||  |||||||| | ||| | |||||| |||||||||||||    
18090603 ttctatttggttcatgtctaacatagtgagaactataataattgattccaataaagtctatgcttcctttcaacatttctttctcgtttttagtgaatt 18090701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0108 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: scaffold0108
Description:

Target: scaffold0108; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 33 - 193
Target Start/End: Complemental strand, 17192 - 17032
Alignment:
33 agaaatattagcttacctgtagttgcagctaatgcatcaaaattgtcaatatagtacattttgcttctatttgattcatgtctagcaaagatagacatat 132  Q
    |||||||||||||||||  ||||||||||||| |||||||||||||||| |  | |||| ||||||||||||||||||||||| ||||| | |||   ||    
17192 agaaatattagcttaccattagttgcagctaaggcatcaaaattgtcaagagggaacatattgcttctatttgattcatgtctggcaaaaacagaataat 17093  T
133 aataattgactccgataaagtctaaacttcctttgagcatatgtttctcctttttagtgaa 193  Q
    ||||||||||||| | |||||||||||||||||||| ||||| || |||||||||||||||    
17092 aataattgactcccacaaagtctaaacttcctttgatcatattttcctcctttttagtgaa 17032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC