View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9045J-LTR4-TNT-insertion-5 (Length: 399)

Name: F9045J-LTR4-TNT-insertion-5
Description: F9045J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9045J-LTR4-TNT-insertion-5
F9045J-LTR4-TNT-insertion-5
[»] chr2 (1 HSPs)
chr2 (8-389)||(38277273-38277654)
[»] chr1 (2 HSPs)
chr1 (267-342)||(36328240-36328315)
chr1 (262-306)||(49197444-49197488)
[»] chr8 (2 HSPs)
chr8 (260-342)||(29610027-29610109)
chr8 (293-329)||(43345427-43345463)
[»] chr4 (1 HSPs)
chr4 (291-329)||(34401679-34401717)


Alignment Details
Target: chr2 (Bit Score: 378; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 8 - 389
Target Start/End: Complemental strand, 38277654 - 38277273
Alignment:
8 tttttatcaaactcacaattattatgattccttttttcaggaaaccgaagtgttaacacataaaaaaggagttagaaatgttttgtacaaacaaaatgtt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38277654 tttttatcaaactcacaattattatgattccttttttcaggaaaccgaagtgttaacacataaaaaaggagttagaaatgttttgtacaaacaaaatgtt 38277555  T
108 attgaaataagattgggcaattaactaattttttggtcgtttagagttaaaatattaccatggcaaattcttatttacccgccaataaaaggtgagtata 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38277554 attgaaataagattgggcaattaactaattttttggtcgtttagagttaaaatattaccatggcaaattcttatttacccgccaataaaaggtgagtata 38277455  T
208 gttatcaatgcatatctgacatcattcaaattcattcatttgtctatcattgtctataacataaatagtgaaagacaaacatctgattttgattggtgtc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38277454 gttatcaatgcatatctgacatcattcaaattcattcatttgtctatcattgtctataacataaatagtgaaagacaaacatctgattttgattggtgtc 38277355  T
308 aactcaagatggataactctacacaccttttgttggtaggtattgcaattagcacctattcatactaataataatagtatta 389  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
38277354 aactcaagatggataactctacacaccttttgttgataggtattgcaattagcacctattcatactaataataatagtatta 38277273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 267 - 342
Target Start/End: Original strand, 36328240 - 36328315
Alignment:
267 cataaatagtgaaagacaaacatctgattttgattggtgtcaactcaagatggataactctacacaccttttgttg 342  Q
    ||||||||||| ||| ||||   |||||||||||||||| |||||||  |||| ||||||||| ||||||||||||    
36328240 cataaatagtggaaggcaaatgactgattttgattggtgccaactcagcatgggtaactctacccaccttttgttg 36328315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 262 - 306
Target Start/End: Original strand, 49197444 - 49197488
Alignment:
262 tataacataaatagtgaaagacaaacatctgattttgattggtgt 306  Q
    |||||||||||||||| |||| ||| || ||||||||||||||||    
49197444 tataacataaatagtggaagataaatatatgattttgattggtgt 49197488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 260 - 342
Target Start/End: Original strand, 29610027 - 29610109
Alignment:
260 tctataacataaatagtgaaagacaaacatctgattttgattggtgtcaactcaagatggataactctacacaccttttgttg 342  Q
    |||||||||||| || ||||||||||| |  | |||||||||| ||||||||||  |||  ||| ||||| ||||||||||||    
29610027 tctataacataagtaatgaaagacaaataaataattttgattgatgtcaactcagcatgtgtaattctactcaccttttgttg 29610109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 293 - 329
Target Start/End: Complemental strand, 43345463 - 43345427
Alignment:
293 attttgattggtgtcaactcaagatggataactctac 329  Q
    ||||| |||||||||||||||| ||||||||||||||    
43345463 attttaattggtgtcaactcaacatggataactctac 43345427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 291 - 329
Target Start/End: Original strand, 34401679 - 34401717
Alignment:
291 tgattttgattggtgtcaactcaagatggataactctac 329  Q
    |||||||||||| ||||||||||| ||||||||||||||    
34401679 tgattttgattgatgtcaactcaatatggataactctac 34401717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98650 times since January 2019
Visitors: 2275