View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9045J-LTR4-TNT-insertion-5 (Length: 399)

Name: F9045J-LTR4-TNT-insertion-5
Description: F9045J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9045J-LTR4-TNT-insertion-5
[»] chr2 (1 HSPs)
chr2 (8-389)||(38277273-38277654)
[»] chr1 (2 HSPs)
chr1 (267-342)||(36328240-36328315)
chr1 (262-306)||(49197444-49197488)
[»] chr8 (2 HSPs)
chr8 (260-342)||(29610027-29610109)
chr8 (293-329)||(43345427-43345463)
[»] chr4 (1 HSPs)
chr4 (291-329)||(34401679-34401717)

Alignment Details
Target: chr2 (Bit Score: 378; Significance: 0; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 8 - 389
Target Start/End: Complemental strand, 38277654 - 38277273
8 tttttatcaaactcacaattattatgattccttttttcaggaaaccgaagtgttaacacataaaaaaggagttagaaatgttttgtacaaacaaaatgtt 107  Q
38277654 tttttatcaaactcacaattattatgattccttttttcaggaaaccgaagtgttaacacataaaaaaggagttagaaatgttttgtacaaacaaaatgtt 38277555  T
108 attgaaataagattgggcaattaactaattttttggtcgtttagagttaaaatattaccatggcaaattcttatttacccgccaataaaaggtgagtata 207  Q
38277554 attgaaataagattgggcaattaactaattttttggtcgtttagagttaaaatattaccatggcaaattcttatttacccgccaataaaaggtgagtata 38277455  T
208 gttatcaatgcatatctgacatcattcaaattcattcatttgtctatcattgtctataacataaatagtgaaagacaaacatctgattttgattggtgtc 307  Q
38277454 gttatcaatgcatatctgacatcattcaaattcattcatttgtctatcattgtctataacataaatagtgaaagacaaacatctgattttgattggtgtc 38277355  T
308 aactcaagatggataactctacacaccttttgttggtaggtattgcaattagcacctattcatactaataataatagtatta 389  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
38277354 aactcaagatggataactctacacaccttttgttgataggtattgcaattagcacctattcatactaataataatagtatta 38277273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 267 - 342
Target Start/End: Original strand, 36328240 - 36328315
267 cataaatagtgaaagacaaacatctgattttgattggtgtcaactcaagatggataactctacacaccttttgttg 342  Q
    ||||||||||| ||| ||||   |||||||||||||||| |||||||  |||| ||||||||| ||||||||||||    
36328240 cataaatagtggaaggcaaatgactgattttgattggtgccaactcagcatgggtaactctacccaccttttgttg 36328315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 262 - 306
Target Start/End: Original strand, 49197444 - 49197488
262 tataacataaatagtgaaagacaaacatctgattttgattggtgt 306  Q
    |||||||||||||||| |||| ||| || ||||||||||||||||    
49197444 tataacataaatagtggaagataaatatatgattttgattggtgt 49197488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr8

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 260 - 342
Target Start/End: Original strand, 29610027 - 29610109
260 tctataacataaatagtgaaagacaaacatctgattttgattggtgtcaactcaagatggataactctacacaccttttgttg 342  Q
    |||||||||||| || ||||||||||| |  | |||||||||| ||||||||||  |||  ||| ||||| ||||||||||||    
29610027 tctataacataagtaatgaaagacaaataaataattttgattgatgtcaactcagcatgtgtaattctactcaccttttgttg 29610109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 293 - 329
Target Start/End: Complemental strand, 43345463 - 43345427
293 attttgattggtgtcaactcaagatggataactctac 329  Q
    ||||| |||||||||||||||| ||||||||||||||    
43345463 attttaattggtgtcaactcaacatggataactctac 43345427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 291 - 329
Target Start/End: Original strand, 34401679 - 34401717
291 tgattttgattggtgtcaactcaagatggataactctac 329  Q
    |||||||||||| ||||||||||| ||||||||||||||    
34401679 tgattttgattgatgtcaactcaatatggataactctac 34401717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC