View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-1 (Length: 424)

Name: F9049J-LTR4-TNT-insertion-1
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9049J-LTR4-TNT-insertion-1
[»] chr3 (3 HSPs)
chr3 (8-414)||(43326885-43327291)
chr3 (177-414)||(4310187-4310426)
chr3 (8-182)||(4311781-4311954)
[»] chr1 (2 HSPs)
chr1 (8-414)||(48199841-48200247)
chr1 (8-414)||(48208424-48208830)
[»] chr6 (1 HSPs)
chr6 (8-341)||(26972664-26972984)

Alignment Details
Target: chr3 (Bit Score: 407; Significance: 0; HSPs: 3)
Name: chr3

Target: chr3; HSP #1
Raw Score: 407; E-Value: 0
Query Start/End: Original strand, 8 - 414
Target Start/End: Complemental strand, 43327291 - 43326885
8 aatatgagtgtcctagtttaggcaaagaagctaattatgttgagcttgattataatgaagaaatgttgctgatgtcatatgtggattgcaatgaagcaaa 107  Q
43327291 aatatgagtgtcctagtttaggcaaagaagctaattatgttgagcttgattataatgaagaaatgttgctgatgtcatatgtggattgcaatgaagcaaa 43327192  T
108 aggagaggatgtgtggtttctggattcgggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 207  Q
43327191 aggagaggatgtgtggtttctggattcgggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 43327092  T
208 aaattgggaaataattcaaggatgtcagtaagaggaaaaggaaatgtaaggttgttagtaagcggtgttgttcatgtagtcacataggtgttttatgtgc 307  Q
43327091 aaattgggaaataattcaaggatgtcagtaagaggaaaaggaaatgtaaggttgttagtaagcggtgttgttcatgtagtcacataggtgttttatgtgc 43326992  T
308 cggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattcaaaatgataagtgtcgaatttaccatccggtgaa 407  Q
43326991 cggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattcaaaatgataagtgtcgaatttaccatccggtgaa 43326892  T
408 aggatta 414  Q
43326891 aggatta 43326885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 177 - 414
Target Start/End: Complemental strand, 4310426 - 4310187
177 tgatctaaacgaaagctttacacaaa--tggtgaaattgggaaataattcaaggatgtcagtaagaggaaaaggaaatgtaaggttgttagtaagcggtg 274  Q
    ||||||||| |||||||||||||| |  | ||||||||  |||||||||||| ||||||||| ||||||||||||||||||| |||||||||||| ||||    
4310426 tgatctaaatgaaagctttacacatagattgtgaaattatgaaataattcaaagatgtcagtgagaggaaaaggaaatgtaatgttgttagtaagtggtg 4310327  T
275 ttgttcatgtagtcacataggtgttttatgtgccggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattca 374  Q
    || | |||||||||||| ||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||    
4310326 ttatgcatgtagtcacaaaggtgttttatgtgcgggagttaaggaatagcttgttgagcattggtcagctacaacaaagaggattatcaattgttattca 4310227  T
375 aaatgataagtgtcgaatttaccatccggtgaaaggatta 414  Q
    | |||| |||||||||||||||||||| ||||||||||||    
4310226 acatgacaagtgtcgaatttaccatccagtgaaaggatta 4310187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 8 - 182
Target Start/End: Complemental strand, 4311954 - 4311781
8 aatatgagtgtcctagtttaggcaaagaagctaattatgttgagcttgattataatgaagaaatgttgctgatgtcatatgtggattgcaatgaagcaaa 107  Q
    |||||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||   |||||||||||||||||   |||||||||||    
4311954 aatatgggtgtcctagtttaggcaaagaagctaattatattgagcttgattataacgaagaaatgtcattgatgtcatatgtggatcataatgaagcaaa 4311855  T
108 aggagaggatgtgtggtttctggattcgggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatct 182  Q
    | ||||||||||||||||||| |||| ||||||||  |||||||||||||| |||||||| ||||||||||||||    
4311854 aagagaggatgtgtggtttct-gatttgggatgcaataatcatatgtgcggtgacaaaaccttgtttagtgatct 4311781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 367; Significance: 0; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 8 - 414
Target Start/End: Original strand, 48199841 - 48200247
8 aatatgagtgtcctagtttaggcaaagaagctaattatgttgagcttgattataatgaagaaatgttgctgatgtcatatgtggattgcaatgaagcaaa 107  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||   |||||||||||    
48199841 aatatgagtgtcctagtttaggcaaagaagctaattatgctgagcttgataataatgaagaaatgttgctgatgtcatatgtggatcataatgaagcaaa 48199940  T
108 aggagaggatgtgtggtttctggattcgggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 207  Q
    | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48199941 aagagaggatgtgtggtttctggattcaggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 48200040  T
208 aaattgggaaataattcaaggatgtcagtaagaggaaaaggaaatgtaaggttgttagtaagcggtgttgttcatgtagtcacataggtgttttatgtgc 307  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||    
48200041 aaattgggaaataattcaagcatgtcagtaagaggaaaaggaaatgtaaggctgttagtaagcggtgttgttcatgtagtcacagaggtgttttatgtgc 48200140  T
308 cggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattcaaaatgataagtgtcgaatttaccatccggtgaa 407  Q
48200141 cggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattcaaaatgataagtgtcgaatttaccatccggtgaa 48200240  T
408 aggatta 414  Q
48200241 aggatta 48200247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 8 - 414
Target Start/End: Original strand, 48208424 - 48208830
8 aatatgagtgtcctagtttaggcaaagaagctaattatgttgagcttgattataatgaagaaatgttgctgatgtcatatgtggattgcaatgaagcaaa 107  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||   |||||||||||    
48208424 aatatgagtgtcctagtttaggcaaagaagctaattatgctgagcttgataataatgaagaaatgttgctgatgtcatatgtggatcataatgaagcaaa 48208523  T
108 aggagaggatgtgtggtttctggattcgggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 207  Q
    | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48208524 aagagaggatgtgtggtttctggattcaggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 48208623  T
208 aaattgggaaataattcaaggatgtcagtaagaggaaaaggaaatgtaaggttgttagtaagcggtgttgttcatgtagtcacataggtgttttatgtgc 307  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||    
48208624 aaattgggaaataattcaagcatgtcagtaagaggaaaaggaaatgtaaggctgttagtaagcggtgttgttcatgtagtcacagaggtgttttatgtgc 48208723  T
308 cggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattcaaaatgataagtgtcgaatttaccatccggtgaa 407  Q
48208724 cggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattcaaaatgataagtgtcgaatttaccatccggtgaa 48208823  T
408 aggatta 414  Q
48208824 aggatta 48208830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 8 - 341
Target Start/End: Complemental strand, 26972984 - 26972664
8 aatatgagtgtcctagtttaggcaaagaagctaattatgttgagcttgattataatgaagaaatgttgctgatgtcatatgtggattgcaatgaagcaaa 107  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||   |||||||||||    
26972984 aatatgagtgtcctagtttaggcaaagaagctaattatgctgagcttgattataatgaagaaatgttgctgatgtcgtatgtggatcataatgaagcaaa 26972885  T
108 aggagaggatgtgtggtttctggattcgggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 207  Q
    | ||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26972884 aagagaggatgtgtggtttttagattcaggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 26972785  T
208 aaattgggaaataattcaaggatgtcagtaagaggaaaaggaaatgtaaggttgttagtaagcggtgttgttcatgtagtcacataggtgttttatgtgc 307  Q
    |||||||||||||             ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||    
26972784 aaattgggaaata-------------agtaagaggaaaaggaaatgtaaggctgttagtaagcggtgttgttcatgtagtcatagaggtgttttatgtgc 26972698  T
308 cggagttaaggaataacttattgagcattggtca 341  Q
    | ||||||||||||||||| ||||||||||||||    
26972697 cagagttaaggaataacttgttgagcattggtca 26972664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC