View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-1 (Length: 424)

Name: F9049J-LTR4-TNT-insertion-1
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9049J-LTR4-TNT-insertion-1
F9049J-LTR4-TNT-insertion-1
[»] chr3 (3 HSPs)
chr3 (8-414)||(43326885-43327291)
chr3 (177-414)||(4310187-4310426)
chr3 (8-182)||(4311781-4311954)
[»] chr1 (2 HSPs)
chr1 (8-414)||(48199841-48200247)
chr1 (8-414)||(48208424-48208830)
[»] chr6 (1 HSPs)
chr6 (8-341)||(26972664-26972984)


Alignment Details
Target: chr3 (Bit Score: 407; Significance: 0; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 407; E-Value: 0
Query Start/End: Original strand, 8 - 414
Target Start/End: Complemental strand, 43327291 - 43326885
Alignment:
8 aatatgagtgtcctagtttaggcaaagaagctaattatgttgagcttgattataatgaagaaatgttgctgatgtcatatgtggattgcaatgaagcaaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43327291 aatatgagtgtcctagtttaggcaaagaagctaattatgttgagcttgattataatgaagaaatgttgctgatgtcatatgtggattgcaatgaagcaaa 43327192  T
108 aggagaggatgtgtggtttctggattcgggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43327191 aggagaggatgtgtggtttctggattcgggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 43327092  T
208 aaattgggaaataattcaaggatgtcagtaagaggaaaaggaaatgtaaggttgttagtaagcggtgttgttcatgtagtcacataggtgttttatgtgc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43327091 aaattgggaaataattcaaggatgtcagtaagaggaaaaggaaatgtaaggttgttagtaagcggtgttgttcatgtagtcacataggtgttttatgtgc 43326992  T
308 cggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattcaaaatgataagtgtcgaatttaccatccggtgaa 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43326991 cggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattcaaaatgataagtgtcgaatttaccatccggtgaa 43326892  T
408 aggatta 414  Q
    |||||||    
43326891 aggatta 43326885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 177 - 414
Target Start/End: Complemental strand, 4310426 - 4310187
Alignment:
177 tgatctaaacgaaagctttacacaaa--tggtgaaattgggaaataattcaaggatgtcagtaagaggaaaaggaaatgtaaggttgttagtaagcggtg 274  Q
    ||||||||| |||||||||||||| |  | ||||||||  |||||||||||| ||||||||| ||||||||||||||||||| |||||||||||| ||||    
4310426 tgatctaaatgaaagctttacacatagattgtgaaattatgaaataattcaaagatgtcagtgagaggaaaaggaaatgtaatgttgttagtaagtggtg 4310327  T
275 ttgttcatgtagtcacataggtgttttatgtgccggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattca 374  Q
    || | |||||||||||| ||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||    
4310326 ttatgcatgtagtcacaaaggtgttttatgtgcgggagttaaggaatagcttgttgagcattggtcagctacaacaaagaggattatcaattgttattca 4310227  T
375 aaatgataagtgtcgaatttaccatccggtgaaaggatta 414  Q
    | |||| |||||||||||||||||||| ||||||||||||    
4310226 acatgacaagtgtcgaatttaccatccagtgaaaggatta 4310187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 8 - 182
Target Start/End: Complemental strand, 4311954 - 4311781
Alignment:
8 aatatgagtgtcctagtttaggcaaagaagctaattatgttgagcttgattataatgaagaaatgttgctgatgtcatatgtggattgcaatgaagcaaa 107  Q
    |||||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||   |||||||||||||||||   |||||||||||    
4311954 aatatgggtgtcctagtttaggcaaagaagctaattatattgagcttgattataacgaagaaatgtcattgatgtcatatgtggatcataatgaagcaaa 4311855  T
108 aggagaggatgtgtggtttctggattcgggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatct 182  Q
    | ||||||||||||||||||| |||| ||||||||  |||||||||||||| |||||||| ||||||||||||||    
4311854 aagagaggatgtgtggtttct-gatttgggatgcaataatcatatgtgcggtgacaaaaccttgtttagtgatct 4311781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 367; Significance: 0; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 8 - 414
Target Start/End: Original strand, 48199841 - 48200247
Alignment:
8 aatatgagtgtcctagtttaggcaaagaagctaattatgttgagcttgattataatgaagaaatgttgctgatgtcatatgtggattgcaatgaagcaaa 107  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||   |||||||||||    
48199841 aatatgagtgtcctagtttaggcaaagaagctaattatgctgagcttgataataatgaagaaatgttgctgatgtcatatgtggatcataatgaagcaaa 48199940  T
108 aggagaggatgtgtggtttctggattcgggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 207  Q
    | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48199941 aagagaggatgtgtggtttctggattcaggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 48200040  T
208 aaattgggaaataattcaaggatgtcagtaagaggaaaaggaaatgtaaggttgttagtaagcggtgttgttcatgtagtcacataggtgttttatgtgc 307  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||    
48200041 aaattgggaaataattcaagcatgtcagtaagaggaaaaggaaatgtaaggctgttagtaagcggtgttgttcatgtagtcacagaggtgttttatgtgc 48200140  T
308 cggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattcaaaatgataagtgtcgaatttaccatccggtgaa 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48200141 cggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattcaaaatgataagtgtcgaatttaccatccggtgaa 48200240  T
408 aggatta 414  Q
    |||||||    
48200241 aggatta 48200247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 8 - 414
Target Start/End: Original strand, 48208424 - 48208830
Alignment:
8 aatatgagtgtcctagtttaggcaaagaagctaattatgttgagcttgattataatgaagaaatgttgctgatgtcatatgtggattgcaatgaagcaaa 107  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||   |||||||||||    
48208424 aatatgagtgtcctagtttaggcaaagaagctaattatgctgagcttgataataatgaagaaatgttgctgatgtcatatgtggatcataatgaagcaaa 48208523  T
108 aggagaggatgtgtggtttctggattcgggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 207  Q
    | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48208524 aagagaggatgtgtggtttctggattcaggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 48208623  T
208 aaattgggaaataattcaaggatgtcagtaagaggaaaaggaaatgtaaggttgttagtaagcggtgttgttcatgtagtcacataggtgttttatgtgc 307  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||    
48208624 aaattgggaaataattcaagcatgtcagtaagaggaaaaggaaatgtaaggctgttagtaagcggtgttgttcatgtagtcacagaggtgttttatgtgc 48208723  T
308 cggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattcaaaatgataagtgtcgaatttaccatccggtgaa 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48208724 cggagttaaggaataacttattgagcattggtcagctacaacaaaaaggattatcaattgttattcaaaatgataagtgtcgaatttaccatccggtgaa 48208823  T
408 aggatta 414  Q
    |||||||    
48208824 aggatta 48208830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 8 - 341
Target Start/End: Complemental strand, 26972984 - 26972664
Alignment:
8 aatatgagtgtcctagtttaggcaaagaagctaattatgttgagcttgattataatgaagaaatgttgctgatgtcatatgtggattgcaatgaagcaaa 107  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||   |||||||||||    
26972984 aatatgagtgtcctagtttaggcaaagaagctaattatgctgagcttgattataatgaagaaatgttgctgatgtcgtatgtggatcataatgaagcaaa 26972885  T
108 aggagaggatgtgtggtttctggattcgggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 207  Q
    | ||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26972884 aagagaggatgtgtggtttttagattcaggatgcagcaatcatatgtgcggagacaaaacgttgtttagtgatctaaacgaaagctttacacaaatggtg 26972785  T
208 aaattgggaaataattcaaggatgtcagtaagaggaaaaggaaatgtaaggttgttagtaagcggtgttgttcatgtagtcacataggtgttttatgtgc 307  Q
    |||||||||||||             ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||    
26972784 aaattgggaaata-------------agtaagaggaaaaggaaatgtaaggctgttagtaagcggtgttgttcatgtagtcatagaggtgttttatgtgc 26972698  T
308 cggagttaaggaataacttattgagcattggtca 341  Q
    | ||||||||||||||||| ||||||||||||||    
26972697 cagagttaaggaataacttgttgagcattggtca 26972664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98541 times since January 2019
Visitors: 2275