View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-10 (Length: 428)

Name: F9049J-LTR4-TNT-insertion-10
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9049J-LTR4-TNT-insertion-10
F9049J-LTR4-TNT-insertion-10
[»] chr4 (1 HSPs)
chr4 (7-418)||(6217079-6217490)


Alignment Details
Target: chr4 (Bit Score: 412; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 412; E-Value: 0
Query Start/End: Original strand, 7 - 418
Target Start/End: Complemental strand, 6217490 - 6217079
Alignment:
7 aggtacaagcttaggaaactagtgaagatgatttccccaatctccaattatggtgaatgaatttgatttggccacataagagcaattaatgtagaaattt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6217490 aggtacaagcttaggaaactagtgaagatgatttccccaatctccaattatggtgaatgaatttgatttggccacataagagcaattaatgtagaaattt 6217391  T
107 atatgagtaatcattgttgaaacacaaagtaaagggaaaactagtactacatcaaattcttattggatcaccaaattattaattgtaaatgaaaaagttg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6217390 atatgagtaatcattgttgaaacacaaagtaaagggaaaactagtactacatcaaattcttattggatcaccaaattattaattgtaaatgaaaaagttg 6217291  T
207 caaatgaagaatataaattcatattatagatgattcatatgtttggcttgcaaacacatctaaccgtccataatgttctaacccctctttaggttcatcc 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6217290 caaatgaagaatataaattcatattatagatgattcatatgtttggcttgcaaacacatctaaccgtccataatgttctaacccctctttaggttcatcc 6217191  T
307 atataactagattgactataatgccatgtacctgcaacaaccattaaggtaatgactactatataccataatcaaaatatgaagatgtagaagatccaat 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6217190 atataactagattgactataatgccatgtacctgcaacaaccattaaggtaatgactactatataccataatcaaaatatgaagatgtagaagatccaat 6217091  T
407 gtaactagaatt 418  Q
    ||||||||||||    
6217090 gtaactagaatt 6217079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105570 times since January 2019
Visitors: 2328