View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-11 (Length: 216)

Name: F9049J-LTR4-TNT-insertion-11
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9049J-LTR4-TNT-insertion-11
F9049J-LTR4-TNT-insertion-11
[»] chr6 (1 HSPs)
chr6 (8-209)||(14987539-14987740)
[»] chr8 (1 HSPs)
chr8 (95-208)||(34989494-34989607)


Alignment Details
Target: chr6 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 8 - 209
Target Start/End: Original strand, 14987539 - 14987740
Alignment:
8 cttcccaatcgccctcatcactgccatgtccataaagttgtcaacaaccacagaaatgcatattttcaccagcatacnnnnnnnnncctggcaatacttg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||    
14987539 cttcccaatcgccctcatcactgccatgtccataaagttgtcaacaaccacagaaatgcatattttcaccagcatattttttttttcctggcaatacttg 14987638  T
108 gggcacggcttctgctatgctgagacttgaatcacttgacaaaccagaaaaaccataaccatccacaatacacgactcttcattcttcgaatatgcaatt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14987639 gggcacggcttctgctatgctgagacttgaatcacttgacaaaccagaaaaaccataaccatccacaatacacgactcttcattcttcgaatatgcaatt 14987738  T
208 gg 209  Q
    ||    
14987739 gg 14987740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 95 - 208
Target Start/End: Original strand, 34989494 - 34989607
Alignment:
95 ctggcaatacttggggcacggcttctgctatgctgagacttgaatcacttgacaaaccagaaaaaccataaccatccacaatacacgactcttcattctt 194  Q
    |||||||||  | |||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||| ||||| |||||||| ||| |||||||||||    
34989494 ctggcaataaattgggcacggcttcagctatgccgagacttgagtcacttgacaaaccagaaaaaccatcaccatgcacaatactcgattcttcattctt 34989593  T
195 cgaatatgcaattg 208  Q
     |||| ||||||||    
34989594 tgaatctgcaattg 34989607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC