View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-11 (Length: 216)

Name: F9049J-LTR4-TNT-insertion-11
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9049J-LTR4-TNT-insertion-11
[»] chr6 (1 HSPs)
chr6 (8-209)||(14987539-14987740)
[»] chr8 (1 HSPs)
chr8 (95-208)||(34989494-34989607)

Alignment Details
Target: chr6 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 8 - 209
Target Start/End: Original strand, 14987539 - 14987740
8 cttcccaatcgccctcatcactgccatgtccataaagttgtcaacaaccacagaaatgcatattttcaccagcatacnnnnnnnnncctggcaatacttg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||    
14987539 cttcccaatcgccctcatcactgccatgtccataaagttgtcaacaaccacagaaatgcatattttcaccagcatattttttttttcctggcaatacttg 14987638  T
108 gggcacggcttctgctatgctgagacttgaatcacttgacaaaccagaaaaaccataaccatccacaatacacgactcttcattcttcgaatatgcaatt 207  Q
14987639 gggcacggcttctgctatgctgagacttgaatcacttgacaaaccagaaaaaccataaccatccacaatacacgactcttcattcttcgaatatgcaatt 14987738  T
208 gg 209  Q
14987739 gg 14987740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 95 - 208
Target Start/End: Original strand, 34989494 - 34989607
95 ctggcaatacttggggcacggcttctgctatgctgagacttgaatcacttgacaaaccagaaaaaccataaccatccacaatacacgactcttcattctt 194  Q
    |||||||||  | |||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||| ||||| |||||||| ||| |||||||||||    
34989494 ctggcaataaattgggcacggcttcagctatgccgagacttgagtcacttgacaaaccagaaaaaccatcaccatgcacaatactcgattcttcattctt 34989593  T
195 cgaatatgcaattg 208  Q
     |||| ||||||||    
34989594 tgaatctgcaattg 34989607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 77570 times since January 2019
Visitors: 2275