View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-12 (Length: 631)

Name: F9049J-LTR4-TNT-insertion-12
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9049J-LTR4-TNT-insertion-12
[»] chr3 (1 HSPs)
chr3 (9-621)||(30592719-30593331)

Alignment Details
Target: chr3 (Bit Score: 609; Significance: 0; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 609; E-Value: 0
Query Start/End: Original strand, 9 - 621
Target Start/End: Complemental strand, 30593331 - 30592719
9 taaggaaaagagcccctacactccacacagaaactgagagacataaggcacgtactacgtacagttagtgcctaactcactagtagtagcagtaccacac 108  Q
30593331 taaggaaaagagcccctacactccacacagaaactgagagacataaggcacgtactacgtacagttagtgcctaactcactagtagtagcagtaccacac 30593232  T
109 actacccatattccaagctttcatttcactctctctcgattggattgatttgatttattttgaaaccaacaacacgactacctaaaaactcttcacgaca 208  Q
30593231 actacccatattccaagctttcatttcactctctctcgattggattgatttgatttattttgaaaccaacaacacgactacctaaaaactcttcacgaca 30593132  T
209 taattcacagaccctcccattgacccattcttcttacaaacacgcaaatcacctgctacagttcagatacaaatttatacagtacatcatataacgtgga 308  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30593131 taattcacagaccctcccattgacccattcttcttacaaacacgtaaatcacctgctacagttcagatacaaatttatacagtacatcatataacgtgga 30593032  T
309 tataaactcgcttggattaacctaacggtgtttgtttaaaacttttgagtgtgttcgtttaaaagtcttgtgtttgattcttttcgtatcagtttttgtg 408  Q
30593031 tataaactcgcttggattaacctaacggtgtttgtttaaaacttttgagtgtgttcgtttaaaagtcttgtgtttgattcttttcgtatcagtttttgtg 30592932  T
409 gattagtttgattttttcataaaaataaggataaatagacgtattccgattatctatatactatagatactttccaaccactaaatgttatatatttata 508  Q
30592931 gattagtttgattttttcataaaaataaggataaatagacgtattccgattatctatatactatagatactttccaaccactaaatgttatatatttata 30592832  T
509 tagaaaatatcaacttacaatgatattacattacgttaatgttacattattccatgattttttacttgttatataaaatgcataaagttttcaccatcat 608  Q
30592831 tagaaaatatcaacttacaatgatattacattacgttaatgttacattattccatgattttttacttgttatataaaatgcataaagttttcaccatcat 30592732  T
609 ttaacgatgatta 621  Q
30592731 ttaacgatgatta 30592719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 94919 times since January 2019
Visitors: 2222