View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-12 (Length: 631)

Name: F9049J-LTR4-TNT-insertion-12
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9049J-LTR4-TNT-insertion-12
F9049J-LTR4-TNT-insertion-12
[»] chr3 (1 HSPs)
chr3 (9-621)||(30592719-30593331)


Alignment Details
Target: chr3 (Bit Score: 609; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 609; E-Value: 0
Query Start/End: Original strand, 9 - 621
Target Start/End: Complemental strand, 30593331 - 30592719
Alignment:
9 taaggaaaagagcccctacactccacacagaaactgagagacataaggcacgtactacgtacagttagtgcctaactcactagtagtagcagtaccacac 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30593331 taaggaaaagagcccctacactccacacagaaactgagagacataaggcacgtactacgtacagttagtgcctaactcactagtagtagcagtaccacac 30593232  T
109 actacccatattccaagctttcatttcactctctctcgattggattgatttgatttattttgaaaccaacaacacgactacctaaaaactcttcacgaca 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30593231 actacccatattccaagctttcatttcactctctctcgattggattgatttgatttattttgaaaccaacaacacgactacctaaaaactcttcacgaca 30593132  T
209 taattcacagaccctcccattgacccattcttcttacaaacacgcaaatcacctgctacagttcagatacaaatttatacagtacatcatataacgtgga 308  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30593131 taattcacagaccctcccattgacccattcttcttacaaacacgtaaatcacctgctacagttcagatacaaatttatacagtacatcatataacgtgga 30593032  T
309 tataaactcgcttggattaacctaacggtgtttgtttaaaacttttgagtgtgttcgtttaaaagtcttgtgtttgattcttttcgtatcagtttttgtg 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30593031 tataaactcgcttggattaacctaacggtgtttgtttaaaacttttgagtgtgttcgtttaaaagtcttgtgtttgattcttttcgtatcagtttttgtg 30592932  T
409 gattagtttgattttttcataaaaataaggataaatagacgtattccgattatctatatactatagatactttccaaccactaaatgttatatatttata 508  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30592931 gattagtttgattttttcataaaaataaggataaatagacgtattccgattatctatatactatagatactttccaaccactaaatgttatatatttata 30592832  T
509 tagaaaatatcaacttacaatgatattacattacgttaatgttacattattccatgattttttacttgttatataaaatgcataaagttttcaccatcat 608  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30592831 tagaaaatatcaacttacaatgatattacattacgttaatgttacattattccatgattttttacttgttatataaaatgcataaagttttcaccatcat 30592732  T
609 ttaacgatgatta 621  Q
    |||||||||||||    
30592731 ttaacgatgatta 30592719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC