View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-2 (Length: 337)

Name: F9049J-LTR4-TNT-insertion-2
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9049J-LTR4-TNT-insertion-2
F9049J-LTR4-TNT-insertion-2
[»] chr7 (2 HSPs)
chr7 (10-330)||(37429978-37430298)
chr7 (198-330)||(37435026-37435160)
[»] chr6 (1 HSPs)
chr6 (10-93)||(12079484-12079567)
[»] chr8 (1 HSPs)
chr8 (10-93)||(32444412-32444495)
[»] chr2 (1 HSPs)
chr2 (17-71)||(25825677-25825731)


Alignment Details
Target: chr7 (Bit Score: 317; Significance: 1e-179; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 10 - 330
Target Start/End: Complemental strand, 37430298 - 37429978
Alignment:
10 attcgtcttcctcaaacagtgaaagttgagaatgttgtttcttctgctgaatgtttgaactcggatcccactgttacggtatgttttaagtaagtggttg 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37430298 attcgtcttcctcaaacagtgaaagttgagaatgttgtttcttctgctgaatgtttgaactcggatcccactgttacggtatgttttaagtaagtggttg 37430199  T
110 atttgaatgatcatatattatggtagtggatgaaacaaaatcccgctgaagggctccctatatccggtcgtataactgcaaccgagccgtttcttcatct 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37430198 atttgaatgatcatatattatggtagtggatgaaacaaaatcccgctgaagggctccctatatccggtcgtataactgcaaccgagccgtttcttcatct 37430099  T
210 ctggttgcctagctggagaattatccatctttctcttgtgattgttcaacaatgatgaagcatcatcatctatcacttccccttcttctgcaatgtattc 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37430098 ctggttgcctagctggagaattatccatctttctcttgtgattgttcaacaatgatgaagcatcatcatctatcacttccccttcttctgcaatgtattc 37429999  T
310 atttatgtctttctgtaattg 330  Q
    ||||||||||||||| |||||    
37429998 atttatgtctttctgcaattg 37429978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 198 - 330
Target Start/End: Original strand, 37435026 - 37435160
Alignment:
198 gtttcttcatctctggttgcctagctggagaattatccatctttctcttgtgattgttcaacaatgatgaagcatcatc--atctatcacttccccttct 295  Q
    |||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||  ||||||||| |||||||||    
37435026 gtttcttcatctctggttgcctagctggaggattatccatctttcttttgtgactgttcaacaatgatgaagcatcatcatatctatcacctccccttct 37435125  T
296 tctgcaatgtattcatttatgtctttctgtaattg 330  Q
    ||||||||||||||||| ||||||||||| |||||    
37435126 tctgcaatgtattcattcatgtctttctgcaattg 37435160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 12079567 - 12079484
Alignment:
10 attcgtcttcctcaaacagtgaaagttgagaatgttgtttcttctgctgaatgtttgaactcggatcccactgttacggtatgt 93  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
12079567 attcttcttcctcaaacagtgaaagttgagaatgttgtttcttctgctgaatgtttgaactcagatcccactgttacggtatgt 12079484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 32444495 - 32444412
Alignment:
10 attcgtcttcctcaaacagtgaaagttgagaatgttgtttcttctgctgaatgtttgaactcggatcccactgttacggtatgt 93  Q
    |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| || ||||||||| |||||||||||    
32444495 attcctcttcctcaaacagtgaaagttgagaatattgtttcttctgctgaatgtttgaattcagatcccactattacggtatgt 32444412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 17 - 71
Target Start/End: Complemental strand, 25825731 - 25825677
Alignment:
17 ttcctcaaacagtgaaagttgagaatgttgtttcttctgctgaatgtttgaactc 71  Q
    ||||| || ||| ||||||||||||||||| ||||||||||||||||||||||||    
25825731 ttccttaatcagggaaagttgagaatgttgcttcttctgctgaatgtttgaactc 25825677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC