View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-2 (Length: 337)

Name: F9049J-LTR4-TNT-insertion-2
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9049J-LTR4-TNT-insertion-2
[»] chr7 (2 HSPs)
chr7 (10-330)||(37429978-37430298)
chr7 (198-330)||(37435026-37435160)
[»] chr6 (1 HSPs)
chr6 (10-93)||(12079484-12079567)
[»] chr8 (1 HSPs)
chr8 (10-93)||(32444412-32444495)
[»] chr2 (1 HSPs)
chr2 (17-71)||(25825677-25825731)

Alignment Details
Target: chr7 (Bit Score: 317; Significance: 1e-179; HSPs: 2)
Name: chr7

Target: chr7; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 10 - 330
Target Start/End: Complemental strand, 37430298 - 37429978
10 attcgtcttcctcaaacagtgaaagttgagaatgttgtttcttctgctgaatgtttgaactcggatcccactgttacggtatgttttaagtaagtggttg 109  Q
37430298 attcgtcttcctcaaacagtgaaagttgagaatgttgtttcttctgctgaatgtttgaactcggatcccactgttacggtatgttttaagtaagtggttg 37430199  T
110 atttgaatgatcatatattatggtagtggatgaaacaaaatcccgctgaagggctccctatatccggtcgtataactgcaaccgagccgtttcttcatct 209  Q
37430198 atttgaatgatcatatattatggtagtggatgaaacaaaatcccgctgaagggctccctatatccggtcgtataactgcaaccgagccgtttcttcatct 37430099  T
210 ctggttgcctagctggagaattatccatctttctcttgtgattgttcaacaatgatgaagcatcatcatctatcacttccccttcttctgcaatgtattc 309  Q
37430098 ctggttgcctagctggagaattatccatctttctcttgtgattgttcaacaatgatgaagcatcatcatctatcacttccccttcttctgcaatgtattc 37429999  T
310 atttatgtctttctgtaattg 330  Q
    ||||||||||||||| |||||    
37429998 atttatgtctttctgcaattg 37429978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 198 - 330
Target Start/End: Original strand, 37435026 - 37435160
198 gtttcttcatctctggttgcctagctggagaattatccatctttctcttgtgattgttcaacaatgatgaagcatcatc--atctatcacttccccttct 295  Q
    |||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||  ||||||||| |||||||||    
37435026 gtttcttcatctctggttgcctagctggaggattatccatctttcttttgtgactgttcaacaatgatgaagcatcatcatatctatcacctccccttct 37435125  T
296 tctgcaatgtattcatttatgtctttctgtaattg 330  Q
    ||||||||||||||||| ||||||||||| |||||    
37435126 tctgcaatgtattcattcatgtctttctgcaattg 37435160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 12079567 - 12079484
10 attcgtcttcctcaaacagtgaaagttgagaatgttgtttcttctgctgaatgtttgaactcggatcccactgttacggtatgt 93  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
12079567 attcttcttcctcaaacagtgaaagttgagaatgttgtttcttctgctgaatgtttgaactcagatcccactgttacggtatgt 12079484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 32444495 - 32444412
10 attcgtcttcctcaaacagtgaaagttgagaatgttgtttcttctgctgaatgtttgaactcggatcccactgttacggtatgt 93  Q
    |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| || ||||||||| |||||||||||    
32444495 attcctcttcctcaaacagtgaaagttgagaatattgtttcttctgctgaatgtttgaattcagatcccactattacggtatgt 32444412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 17 - 71
Target Start/End: Complemental strand, 25825731 - 25825677
17 ttcctcaaacagtgaaagttgagaatgttgtttcttctgctgaatgtttgaactc 71  Q
    ||||| || ||| ||||||||||||||||| ||||||||||||||||||||||||    
25825731 ttccttaatcagggaaagttgagaatgttgcttcttctgctgaatgtttgaactc 25825677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98169 times since January 2019
Visitors: 2269