View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-3 (Length: 227)

Name: F9049J-LTR4-TNT-insertion-3
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9049J-LTR4-TNT-insertion-3
[»] chr4 (1 HSPs)
chr4 (7-218)||(55970985-55971196)

Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 218
Target Start/End: Original strand, 55970985 - 55971196
7 atgtctatggtctcatgcctaaaagatcattgaagcccttattaccacctcctgaagccttgctttccattggtcactatcattcaacatgtccagatgc 106  Q
55970985 atgtctatggtctcatgcctaaaagatcattgaagcccttattaccacctcctgaagccttgctttccattggtcactatcattcaacatgtccagatgc 55971084  T
107 tgaaggcattatctcacaaaaagtttttgcttgggttaagaaggaccccaccttggcaccatccatcatccgcttgcattttcatgactgtgccgttaga 206  Q
55971085 tgaaggcattatctcacaaaaagtttttgcttgggttaagaaggaccccaccttggcaccatccatcatccgcttgcattttcatgactgtgccgttaga 55971184  T
207 gtaatttaatta 218  Q
55971185 gtaatttaatta 55971196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98246 times since January 2019
Visitors: 2271