View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-7 (Length: 284)

Name: F9049J-LTR4-TNT-insertion-7
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9049J-LTR4-TNT-insertion-7
F9049J-LTR4-TNT-insertion-7
[»] chr4 (1 HSPs)
chr4 (10-275)||(52036655-52036920)


Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 10 - 275
Target Start/End: Original strand, 52036655 - 52036920
Alignment:
10 tatagctagagctgttgttgcttctatacattcatcaaaagatgataacaacaatggtattagtcaacttcaaaggtttcagtatcaagttactgaattg 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52036655 tatagctagagctgttgttgcttctatacattcatcaaaagatgataacaacaatggtattagtcaacttcaaaggtttcagtatcaagttactgaattg 52036754  T
110 ttcaagggattttcaagtgttcaaaatgaaaatactaattacaatcctgaaatcctcactactctcaagcgtcaatgggctgcaaattttcacttgaagt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52036755 ttcaagggattttcaagtgttcaaaatgaaaatactaattacaatcctgaaatcctcactactctcaagcgtcaatgggctgcaaattttcacttgaagt 52036854  T
210 acatggtatcatgcttaataagctgtttgcttcttgttacttttaggatctttcctttgctaattg 275  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
52036855 acatggtatcatgcttaataagctgtttgcttcttgttacttttaggatctttcctttgccaattg 52036920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC