View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-7 (Length: 284)

Name: F9049J-LTR4-TNT-insertion-7
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9049J-LTR4-TNT-insertion-7
[»] chr4 (1 HSPs)
chr4 (10-275)||(52036655-52036920)

Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 10 - 275
Target Start/End: Original strand, 52036655 - 52036920
10 tatagctagagctgttgttgcttctatacattcatcaaaagatgataacaacaatggtattagtcaacttcaaaggtttcagtatcaagttactgaattg 109  Q
52036655 tatagctagagctgttgttgcttctatacattcatcaaaagatgataacaacaatggtattagtcaacttcaaaggtttcagtatcaagttactgaattg 52036754  T
110 ttcaagggattttcaagtgttcaaaatgaaaatactaattacaatcctgaaatcctcactactctcaagcgtcaatgggctgcaaattttcacttgaagt 209  Q
52036755 ttcaagggattttcaagtgttcaaaatgaaaatactaattacaatcctgaaatcctcactactctcaagcgtcaatgggctgcaaattttcacttgaagt 52036854  T
210 acatggtatcatgcttaataagctgtttgcttcttgttacttttaggatctttcctttgctaattg 275  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
52036855 acatggtatcatgcttaataagctgtttgcttcttgttacttttaggatctttcctttgccaattg 52036920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 84214 times since January 2019
Visitors: 2323