View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-8 (Length: 223)

Name: F9049J-LTR4-TNT-insertion-8
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9049J-LTR4-TNT-insertion-8
F9049J-LTR4-TNT-insertion-8
[»] chr7 (1 HSPs)
chr7 (8-213)||(1809237-1809442)


Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 1809237 - 1809442
Alignment:
8 acaacgactcaataggaaacttggcagtgacattttcattgctgcaaatacagcacaaatgcacaaagactttgttactaatccaacagcttatggtact 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1809237 acaacgactcaataggaaacttggcagtgacattttcattgctgcaaatacagcacaaatgcacaaagactttgttactaatccaacagcttatggtact 1809336  T
108 aatactttatattagactctattgccaactttcattttcaacaactagtttctcattattgaagtaacaaatagattagtaacatttaatttatgttgtt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1809337 aatactttatattagactctattgccaactttcattttcaacaactagtttctcattattgaagtaacaaatagattagtaacatttaatttatgttgtt 1809436  T
208 gaatta 213  Q
    ||||||    
1809437 gaatta 1809442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC