View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-8 (Length: 223)

Name: F9049J-LTR4-TNT-insertion-8
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9049J-LTR4-TNT-insertion-8
[»] chr7 (1 HSPs)
chr7 (8-213)||(1809237-1809442)

Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 1809237 - 1809442
8 acaacgactcaataggaaacttggcagtgacattttcattgctgcaaatacagcacaaatgcacaaagactttgttactaatccaacagcttatggtact 107  Q
1809237 acaacgactcaataggaaacttggcagtgacattttcattgctgcaaatacagcacaaatgcacaaagactttgttactaatccaacagcttatggtact 1809336  T
108 aatactttatattagactctattgccaactttcattttcaacaactagtttctcattattgaagtaacaaatagattagtaacatttaatttatgttgtt 207  Q
1809337 aatactttatattagactctattgccaactttcattttcaacaactagtttctcattattgaagtaacaaatagattagtaacatttaatttatgttgtt 1809436  T
208 gaatta 213  Q
1809437 gaatta 1809442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 105527 times since January 2019
Visitors: 2328