View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-9 (Length: 743)

Name: F9049J-LTR4-TNT-insertion-9
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9049J-LTR4-TNT-insertion-9
[»] chr1 (2 HSPs)
chr1 (8-743)||(39102328-39103063)
chr1 (540-672)||(52218319-52218458)
[»] chr6 (1 HSPs)
chr6 (412-508)||(34539755-34539851)
[»] chr2 (1 HSPs)
chr2 (535-605)||(7824126-7824196)

Alignment Details
Target: chr1 (Bit Score: 694; Significance: 0; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 694; E-Value: 0
Query Start/End: Original strand, 8 - 743
Target Start/End: Original strand, 39102328 - 39103063
8 tcaaataattcctggtccctatttcatttacaagcaaaacaaagacagacttaacaacctacccatatggtcttcaaagatgtctctaactcaccaatgn 107  Q
39102328 tcaaataattcctggtccctatttcatttacaagcaaaacaaagacagacttaacaacctacccatatggtcttcaaagatgtctctaactcaccaatga 39102427  T
108 nnnnnngaaatggatcatgccatcatggaaaagttattttaaaattaacttggaattggaactagctttattgctagtggatagagtagaggaggggaca 207  Q
39102428 aaaaaagaaatggatcatgccatcatggaaaagttattttaaaattaacttggaattggaactagctttattgctagtggatagagtagaggaggggaca 39102527  T
208 ttgaaatgaaggtttcaatcatatagtactaaaatagaatggagtgttgagtggtacatagaaatgatttatgtcatatagggtagccaatgcccaccaa 307  Q
39102528 ttgaaatgaaggtttcaatcatatagtactaaaatagaatggagtgttgagtggtacatagaaatgatttatgtcatatagggtagccaatgcccaccaa 39102627  T
308 aggaatgannnnnnnttagaaattagggttttgtgcggtcataatgaacgcacactttcaagctttcgtaaatctaaatcacttatagtgtgtttgaggt 407  Q
    ||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39102628 aggaatgacccccccttagaaattagggttttgtgcggtcataatgaacgcacactttcaagctttcgtaaatctaaatcacttatagtgtgtttgaggt 39102727  T
408 ggtatttgtaacacaattcccgcttccgaatgtaacttcaacaccacttttatgaagttggaaatcctagcttcagcctaaacgtggttttgctgcctgt 507  Q
39102728 ggtatttgtaacacaattcccgcttccgaatgtaacttcaacaccacttttatgaagttggaaatcctagcttcagcctaaacgtggttttgctgcctgt 39102827  T
508 ttaccgcaattccaaacacatgcttagtggttgtttgtcttcactttaaaatcaaagtaaactcacgtttaggccactgctacattttgtagcttctcaa 607  Q
39102828 ttaccgcaattccaaacacatgcttagtggttgtttgtcttcactttaaaatcaaagtaaactcacgtttaggccactgctacattttgtagcttctcaa 39102927  T
608 atttcacgttgcaaatgctctgggatgcgagaatttggatgcagaagttgttccaaacatcctattaatcaagattaaatgttttatatttcaaccttgt 707  Q
39102928 atttcacgttgcaaatgctctgggatgcgagaatttggatgcagaagttgttccaaacatcctattaatcaagattaaatgttttatatttcaaccttgt 39103027  T
708 tttttaggtttcagaaaatttaatggttattcaatc 743  Q
39103028 tttttaggtttcagaaaatttaatggttattcaatc 39103063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 540 - 672
Target Start/End: Complemental strand, 52218458 - 52218319
540 gtttgtcttcactttaaaatcaaagtaaactcacgtttaggccactgctacattttgtagcttctcaaatttcacgttgcaaatgct-------ctggga 632  Q
    |||||| |||||||||||||||||||||| ||||||||||||||||  |||||||  ||||||||| |||||||||||||| |||||        || ||    
52218458 gtttgttttcactttaaaatcaaagtaaagtcacgtttaggccactcttacatttcatagcttctcgaatttcacgttgcacatgctttgagagttgaga 52218359  T
633 tgcgagaatttggatgcagaagttgttccaaacatcctat 672  Q
     ||||||||||||||||  |||||||||||||||| ||||    
52218358 cgcgagaatttggatgcgaaagttgttccaaacatgctat 52218319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 45; Significance: 3e-16; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 412 - 508
Target Start/End: Original strand, 34539755 - 34539851
412 tttgtaacacaattcccgcttccgaatgtaacttcaacaccacttttatgaagttggaaatcctagcttcagcctaaacgtggttttgctgcctgtt 508  Q
    ||||||||||||||   |||| | |||| ||||||||| |||||| ||||| | ||||||||||| ||||| ||||||||||||||||||| |||||    
34539755 tttgtaacacaatttatgctttccaatggaacttcaacgccacttctatgaggctggaaatcctaacttcaacctaaacgtggttttgctgactgtt 34539851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 535 - 605
Target Start/End: Original strand, 7824126 - 7824196
535 tggttgtttgtcttcactttaaaatcaaagtaaactcacgtttaggccactgctacattttgtagcttctc 605  Q
    ||||||||||| ||||| || ||||||||||||| | |||||||||||||| |||||||| ||||||||||    
7824126 tggttgtttgttttcacgttgaaatcaaagtaaaattacgtttaggccactcctacatttcgtagcttctc 7824196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC