View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-9 (Length: 743)

Name: F9049J-LTR4-TNT-insertion-9
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9049J-LTR4-TNT-insertion-9
F9049J-LTR4-TNT-insertion-9
[»] chr1 (2 HSPs)
chr1 (8-743)||(39102328-39103063)
chr1 (540-672)||(52218319-52218458)
[»] chr6 (1 HSPs)
chr6 (412-508)||(34539755-34539851)
[»] chr2 (1 HSPs)
chr2 (535-605)||(7824126-7824196)


Alignment Details
Target: chr1 (Bit Score: 694; Significance: 0; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 694; E-Value: 0
Query Start/End: Original strand, 8 - 743
Target Start/End: Original strand, 39102328 - 39103063
Alignment:
8 tcaaataattcctggtccctatttcatttacaagcaaaacaaagacagacttaacaacctacccatatggtcttcaaagatgtctctaactcaccaatgn 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
39102328 tcaaataattcctggtccctatttcatttacaagcaaaacaaagacagacttaacaacctacccatatggtcttcaaagatgtctctaactcaccaatga 39102427  T
108 nnnnnngaaatggatcatgccatcatggaaaagttattttaaaattaacttggaattggaactagctttattgctagtggatagagtagaggaggggaca 207  Q
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39102428 aaaaaagaaatggatcatgccatcatggaaaagttattttaaaattaacttggaattggaactagctttattgctagtggatagagtagaggaggggaca 39102527  T
208 ttgaaatgaaggtttcaatcatatagtactaaaatagaatggagtgttgagtggtacatagaaatgatttatgtcatatagggtagccaatgcccaccaa 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39102528 ttgaaatgaaggtttcaatcatatagtactaaaatagaatggagtgttgagtggtacatagaaatgatttatgtcatatagggtagccaatgcccaccaa 39102627  T
308 aggaatgannnnnnnttagaaattagggttttgtgcggtcataatgaacgcacactttcaagctttcgtaaatctaaatcacttatagtgtgtttgaggt 407  Q
    ||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39102628 aggaatgacccccccttagaaattagggttttgtgcggtcataatgaacgcacactttcaagctttcgtaaatctaaatcacttatagtgtgtttgaggt 39102727  T
408 ggtatttgtaacacaattcccgcttccgaatgtaacttcaacaccacttttatgaagttggaaatcctagcttcagcctaaacgtggttttgctgcctgt 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39102728 ggtatttgtaacacaattcccgcttccgaatgtaacttcaacaccacttttatgaagttggaaatcctagcttcagcctaaacgtggttttgctgcctgt 39102827  T
508 ttaccgcaattccaaacacatgcttagtggttgtttgtcttcactttaaaatcaaagtaaactcacgtttaggccactgctacattttgtagcttctcaa 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39102828 ttaccgcaattccaaacacatgcttagtggttgtttgtcttcactttaaaatcaaagtaaactcacgtttaggccactgctacattttgtagcttctcaa 39102927  T
608 atttcacgttgcaaatgctctgggatgcgagaatttggatgcagaagttgttccaaacatcctattaatcaagattaaatgttttatatttcaaccttgt 707  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39102928 atttcacgttgcaaatgctctgggatgcgagaatttggatgcagaagttgttccaaacatcctattaatcaagattaaatgttttatatttcaaccttgt 39103027  T
708 tttttaggtttcagaaaatttaatggttattcaatc 743  Q
    ||||||||||||||||||||||||||||||||||||    
39103028 tttttaggtttcagaaaatttaatggttattcaatc 39103063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 540 - 672
Target Start/End: Complemental strand, 52218458 - 52218319
Alignment:
540 gtttgtcttcactttaaaatcaaagtaaactcacgtttaggccactgctacattttgtagcttctcaaatttcacgttgcaaatgct-------ctggga 632  Q
    |||||| |||||||||||||||||||||| ||||||||||||||||  |||||||  ||||||||| |||||||||||||| |||||        || ||    
52218458 gtttgttttcactttaaaatcaaagtaaagtcacgtttaggccactcttacatttcatagcttctcgaatttcacgttgcacatgctttgagagttgaga 52218359  T
633 tgcgagaatttggatgcagaagttgttccaaacatcctat 672  Q
     ||||||||||||||||  |||||||||||||||| ||||    
52218358 cgcgagaatttggatgcgaaagttgttccaaacatgctat 52218319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 45; Significance: 3e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 412 - 508
Target Start/End: Original strand, 34539755 - 34539851
Alignment:
412 tttgtaacacaattcccgcttccgaatgtaacttcaacaccacttttatgaagttggaaatcctagcttcagcctaaacgtggttttgctgcctgtt 508  Q
    ||||||||||||||   |||| | |||| ||||||||| |||||| ||||| | ||||||||||| ||||| ||||||||||||||||||| |||||    
34539755 tttgtaacacaatttatgctttccaatggaacttcaacgccacttctatgaggctggaaatcctaacttcaacctaaacgtggttttgctgactgtt 34539851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 535 - 605
Target Start/End: Original strand, 7824126 - 7824196
Alignment:
535 tggttgtttgtcttcactttaaaatcaaagtaaactcacgtttaggccactgctacattttgtagcttctc 605  Q
    ||||||||||| ||||| || ||||||||||||| | |||||||||||||| |||||||| ||||||||||    
7824126 tggttgtttgttttcacgttgaaatcaaagtaaaattacgtttaggccactcctacatttcgtagcttctc 7824196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93572 times since January 2019
Visitors: 2365