View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9072J-LTR4-TNT-insertion-1 (Length: 378)

Name: F9072J-LTR4-TNT-insertion-1
Description: F9072J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9072J-LTR4-TNT-insertion-1
F9072J-LTR4-TNT-insertion-1
[»] chr2 (1 HSPs)
chr2 (8-368)||(37244602-37244962)


Alignment Details
Target: chr2 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 8 - 368
Target Start/End: Complemental strand, 37244962 - 37244602
Alignment:
8 gttcaaaattcaagatggtaataaaggaaatgatggtaattcttctacaagtgggattatgaggattaagctagttgtgagcaaggaagagttgaaaagg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37244962 gttcaaaattcaagatggtaataaaggaaatgatggtaattcttctacaagtgggattatgaggattaagctagttgtgagcaaggaagagttgaaaagg 37244863  T
108 gtgttgagtaataagaatattgaaaatggtgttaagaatacttctttggaggaattgctaaaagatatgaagttgaaagaaaaaagtgtgtctagggttg 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37244862 gtgttgagtaataagaatattgaaaatggtgttaagaatacttctttggaggaattgctaaaagatatgaagttgaaagaaaaaagtgtgtctagggttg 37244763  T
208 aggaaattgatgatgggggattagattcttggaagccagctttagatagtattcctgaggatcactccatgaagctataggtagtaaattgtcatgaaca 307  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37244762 aagaaattgatgatgggggattagattcttggaagccagctttagatagtattcctgaggatcactccatgaagctataggtagtaaattgtcatgaaca 37244663  T
308 atcctatattatgtaaataaagacaatatatgtttttatttatttgatagtgcattgaatt 368  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37244662 atcctatattatgtaaataaagacaatatatgtttttatttatttgatagtgcattgaatt 37244602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC