View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9072J-LTR4-TNT-insertion-1 (Length: 378)

Name: F9072J-LTR4-TNT-insertion-1
Description: F9072J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9072J-LTR4-TNT-insertion-1
[»] chr2 (1 HSPs)
chr2 (8-368)||(37244602-37244962)

Alignment Details
Target: chr2 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 8 - 368
Target Start/End: Complemental strand, 37244962 - 37244602
8 gttcaaaattcaagatggtaataaaggaaatgatggtaattcttctacaagtgggattatgaggattaagctagttgtgagcaaggaagagttgaaaagg 107  Q
37244962 gttcaaaattcaagatggtaataaaggaaatgatggtaattcttctacaagtgggattatgaggattaagctagttgtgagcaaggaagagttgaaaagg 37244863  T
108 gtgttgagtaataagaatattgaaaatggtgttaagaatacttctttggaggaattgctaaaagatatgaagttgaaagaaaaaagtgtgtctagggttg 207  Q
37244862 gtgttgagtaataagaatattgaaaatggtgttaagaatacttctttggaggaattgctaaaagatatgaagttgaaagaaaaaagtgtgtctagggttg 37244763  T
208 aggaaattgatgatgggggattagattcttggaagccagctttagatagtattcctgaggatcactccatgaagctataggtagtaaattgtcatgaaca 307  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37244762 aagaaattgatgatgggggattagattcttggaagccagctttagatagtattcctgaggatcactccatgaagctataggtagtaaattgtcatgaaca 37244663  T
308 atcctatattatgtaaataaagacaatatatgtttttatttatttgatagtgcattgaatt 368  Q
37244662 atcctatattatgtaaataaagacaatatatgtttttatttatttgatagtgcattgaatt 37244602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 94903 times since January 2019
Visitors: 2221