View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9072J-LTR4-TNT-insertion-2 (Length: 439)

Name: F9072J-LTR4-TNT-insertion-2
Description: F9072J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9072J-LTR4-TNT-insertion-2
F9072J-LTR4-TNT-insertion-2
[»] chr1 (2 HSPs)
chr1 (8-430)||(35618633-35619055)
chr1 (8-40)||(52833121-52833153)
[»] chr2 (2 HSPs)
chr2 (317-424)||(5729922-5730032)
chr2 (345-424)||(5800468-5800550)
[»] chr8 (2 HSPs)
chr8 (8-40)||(25139902-25139934)
chr8 (8-40)||(30542812-30542844)
[»] chr7 (1 HSPs)
chr7 (8-40)||(35195891-35195923)


Alignment Details
Target: chr1 (Bit Score: 423; Significance: 0; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 423; E-Value: 0
Query Start/End: Original strand, 8 - 430
Target Start/End: Complemental strand, 35619055 - 35618633
Alignment:
8 cggggttcgaaccccgaacatcccatttattcaacctattctcttcatcatcatttcaattttgaggcatatggggatcaaccacctttagaagaaatta 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35619055 cggggttcgaaccccgaacatcccatttattcaacctattctcttcatcatcatttcaattttgaggcatatggggatcaaccacctttagaagaaatta 35618956  T
108 tcgaatgaggctcatcaatcttagcagatttaattgccttttactgtccagaaattggagattaatttcctttaaaataaatgaccgggtgtgggtctta 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35618955 tcgaatgaggctcatcaatcttagcagatttaattgccttttactgtccagaaattggagattaatttcctttaaaataaatgaccgggtgtgggtctta 35618856  T
208 gcgggtaatttgccttttaataccttactcatcagctcaaaaactttttaattttaggttggctcatatttcagaggtattcaatttaacaaaggacaac 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35618855 gcgggtaatttgccttttaataccttactcatcagctcaaaaactttttaattttaggttggctcatatttcagaggtattcaatttaacaaaggacaac 35618756  T
308 catatttcctttatttaaagtatctatttcttctatacaagcttcacaagaagataaccaagttcaataatattataagacaagagtatggggatcatga 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35618755 catatttcctttatttaaagtatctatttcttctatacaagcttcacaagaagataaccaagttcaataatattataagacaagagtatggggatcatga 35618656  T
408 atttaagagatttataacaattg 430  Q
    |||||||||||||||||||||||    
35618655 atttaagagatttataacaattg 35618633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 8 - 40
Target Start/End: Complemental strand, 52833153 - 52833121
Alignment:
8 cggggttcgaaccccgaacatcccatttattca 40  Q
    |||||||||||||||| ||||||||||||||||    
52833153 cggggttcgaaccccggacatcccatttattca 52833121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 317 - 424
Target Start/End: Original strand, 5729922 - 5730032
Alignment:
317 tttatttaaagtatctatttcttctatacaagcttcacaagaagataaccaagttc-aataatattataagac-aagagtatg-gggatcatgaatttaa 413  Q
    |||||||||||||||||||| ||| ||  ||||||||||| ||||||| ||||||| |||||| ||||||||| |||||| || || |||||||||||||    
5729922 tttatttaaagtatctattttttccatggaagcttcacaaaaagataatcaagttcaaataattttataagacaaagagtgtgtggaatcatgaatttaa 5730021  T
414 gagatttataa 424  Q
     ||||||||||    
5730022 aagatttataa 5730032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 424
Target Start/End: Original strand, 5800468 - 5800550
Alignment:
345 caagcttcacaagaagataaccaagttc-aataatattataagac-aagagtatg-gggatcatgaatttaagagatttataa 424  Q
    |||||||||||| ||||||| ||||||| |||||| ||||||||| |||||| || || ||||||||||||| ||||||||||    
5800468 caagcttcacaaaaagataatcaagttcaaataattttataagacaaagagtgtgtggaatcatgaatttaaaagatttataa 5800550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 8 - 40
Target Start/End: Complemental strand, 25139934 - 25139902
Alignment:
8 cggggttcgaaccccgaacatcccatttattca 40  Q
    ||||||||||||||||||||||||| |||||||    
25139934 cggggttcgaaccccgaacatcccacttattca 25139902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 8 - 40
Target Start/End: Original strand, 30542812 - 30542844
Alignment:
8 cggggttcgaaccccgaacatcccatttattca 40  Q
    ||||||||||||||||||||| |||||||||||    
30542812 cggggttcgaaccccgaacattccatttattca 30542844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 8 - 40
Target Start/End: Original strand, 35195891 - 35195923
Alignment:
8 cggggttcgaaccccgaacatcccatttattca 40  Q
    |||||||||||||||||||| ||||||||||||    
35195891 cggggttcgaaccccgaacaccccatttattca 35195923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105543 times since January 2019
Visitors: 2328