View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9072J-LTR4-TNT-insertion-2 (Length: 439)

Name: F9072J-LTR4-TNT-insertion-2
Description: F9072J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9072J-LTR4-TNT-insertion-2
[»] chr1 (2 HSPs)
chr1 (8-430)||(35618633-35619055)
chr1 (8-40)||(52833121-52833153)
[»] chr2 (2 HSPs)
chr2 (317-424)||(5729922-5730032)
chr2 (345-424)||(5800468-5800550)
[»] chr8 (2 HSPs)
chr8 (8-40)||(25139902-25139934)
chr8 (8-40)||(30542812-30542844)
[»] chr7 (1 HSPs)
chr7 (8-40)||(35195891-35195923)

Alignment Details
Target: chr1 (Bit Score: 423; Significance: 0; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 423; E-Value: 0
Query Start/End: Original strand, 8 - 430
Target Start/End: Complemental strand, 35619055 - 35618633
8 cggggttcgaaccccgaacatcccatttattcaacctattctcttcatcatcatttcaattttgaggcatatggggatcaaccacctttagaagaaatta 107  Q
35619055 cggggttcgaaccccgaacatcccatttattcaacctattctcttcatcatcatttcaattttgaggcatatggggatcaaccacctttagaagaaatta 35618956  T
108 tcgaatgaggctcatcaatcttagcagatttaattgccttttactgtccagaaattggagattaatttcctttaaaataaatgaccgggtgtgggtctta 207  Q
35618955 tcgaatgaggctcatcaatcttagcagatttaattgccttttactgtccagaaattggagattaatttcctttaaaataaatgaccgggtgtgggtctta 35618856  T
208 gcgggtaatttgccttttaataccttactcatcagctcaaaaactttttaattttaggttggctcatatttcagaggtattcaatttaacaaaggacaac 307  Q
35618855 gcgggtaatttgccttttaataccttactcatcagctcaaaaactttttaattttaggttggctcatatttcagaggtattcaatttaacaaaggacaac 35618756  T
308 catatttcctttatttaaagtatctatttcttctatacaagcttcacaagaagataaccaagttcaataatattataagacaagagtatggggatcatga 407  Q
35618755 catatttcctttatttaaagtatctatttcttctatacaagcttcacaagaagataaccaagttcaataatattataagacaagagtatggggatcatga 35618656  T
408 atttaagagatttataacaattg 430  Q
35618655 atttaagagatttataacaattg 35618633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 8 - 40
Target Start/End: Complemental strand, 52833153 - 52833121
8 cggggttcgaaccccgaacatcccatttattca 40  Q
    |||||||||||||||| ||||||||||||||||    
52833153 cggggttcgaaccccggacatcccatttattca 52833121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 317 - 424
Target Start/End: Original strand, 5729922 - 5730032
317 tttatttaaagtatctatttcttctatacaagcttcacaagaagataaccaagttc-aataatattataagac-aagagtatg-gggatcatgaatttaa 413  Q
    |||||||||||||||||||| ||| ||  ||||||||||| ||||||| ||||||| |||||| ||||||||| |||||| || || |||||||||||||    
5729922 tttatttaaagtatctattttttccatggaagcttcacaaaaagataatcaagttcaaataattttataagacaaagagtgtgtggaatcatgaatttaa 5730021  T
414 gagatttataa 424  Q
5730022 aagatttataa 5730032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 424
Target Start/End: Original strand, 5800468 - 5800550
345 caagcttcacaagaagataaccaagttc-aataatattataagac-aagagtatg-gggatcatgaatttaagagatttataa 424  Q
    |||||||||||| ||||||| ||||||| |||||| ||||||||| |||||| || || ||||||||||||| ||||||||||    
5800468 caagcttcacaaaaagataatcaagttcaaataattttataagacaaagagtgtgtggaatcatgaatttaaaagatttataa 5800550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr8

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 8 - 40
Target Start/End: Complemental strand, 25139934 - 25139902
8 cggggttcgaaccccgaacatcccatttattca 40  Q
    ||||||||||||||||||||||||| |||||||    
25139934 cggggttcgaaccccgaacatcccacttattca 25139902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 8 - 40
Target Start/End: Original strand, 30542812 - 30542844
8 cggggttcgaaccccgaacatcccatttattca 40  Q
    ||||||||||||||||||||| |||||||||||    
30542812 cggggttcgaaccccgaacattccatttattca 30542844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 8 - 40
Target Start/End: Original strand, 35195891 - 35195923
8 cggggttcgaaccccgaacatcccatttattca 40  Q
    |||||||||||||||||||| ||||||||||||    
35195891 cggggttcgaaccccgaacaccccatttattca 35195923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC