View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9072J-LTR4-TNT-insertion-3 (Length: 267)

Name: F9072J-LTR4-TNT-insertion-3
Description: F9072J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9072J-LTR4-TNT-insertion-3
F9072J-LTR4-TNT-insertion-3
[»] chr7 (4 HSPs)
chr7 (10-257)||(25745250-25745497)
chr7 (20-257)||(25739243-25739478)
chr7 (12-165)||(25731314-25731463)
chr7 (171-257)||(25731707-25731792)
[»] chr1 (1 HSPs)
chr1 (154-245)||(45300271-45300362)


Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 10 - 257
Target Start/End: Original strand, 25745250 - 25745497
Alignment:
10 cacaagcatcagagtgcaaaaaaggaccaagagaatttggagactgatcatataattaactatagttttgcatgatcacaactcaagttatcatgttgtt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25745250 cacaagcatcagagtgcaaaaaaggaccaagagaatttggagactgatcatataattaactatagttttgcatgatcacaactcaagttatcatgttgtt 25745349  T
110 ctctacacttattcgattatcgaaagaaatgctgaactttgactttgacaaaatcaccaaccattcgtctaaaatgcataatcaactggtagccacaaac 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25745350 ctctacacttattcgattatcgaaagaaatgctgaactttgactttgacaaaatcaccaaccattcgtctaaaatgcataatcaactggtagccacaaac 25745449  T
210 acggccaattttgttgcatgaaaggcgattaaccaccacagaagaatt 257  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
25745450 acggccaattttgttgcatgaaaggcgattaaccaccacagaagaatt 25745497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 20 - 257
Target Start/End: Original strand, 25739243 - 25739478
Alignment:
20 agagtgcaaaaaaggaccaagagaatttggagactgatcatataattaactatagttttgcatgatcacaactcaagttatcatgttgttctctacactt 119  Q
    |||||||| |||||||||||||||||| || ||| ||||||| ||  ||||| ||||||  ||||||| ||||||||||||||||||| ||  | |||||    
25739243 agagtgcataaaaggaccaagagaattaggcgacggatcataaaa--aactaaagttttatatgatcataactcaagttatcatgttgatccgtgcactt 25739340  T
120 attcgattatcgaaagaaatgctgaactttgactttgacaaaatcaccaaccattcgtctaaaatgcataatcaactggtagccacaaacacggccaatt 219  Q
    |||| ||||| || || ||| ||||||||||||||||| || |||||||| ||||| |||||||||||||||||||||||||||||||||||| ||| ||    
25739341 attcaattattgagaggaatactgaactttgactttgagaagatcaccaagcattcttctaaaatgcataatcaactggtagccacaaacacgaccactt 25739440  T
220 ttgttgcatgaaaggcgattaaccaccacagaagaatt 257  Q
    ||||||| | ||| ||||||||||||||||||||||||    
25739441 ttgttgcgtaaaatgcgattaaccaccacagaagaatt 25739478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 12 - 165
Target Start/End: Original strand, 25731314 - 25731463
Alignment:
12 caagcatcagagtgcaaaaaaggaccaagagaatttggagactgatcatataattaactatagttttgcatgatcacaactcaagttatcatgttgttct 111  Q
    ||||||| ||||||||||||| |||  |||||||| || ||||||||||| ||  ||||| ||||||  |||||||| |||||||||||||||||| ||     
25731314 caagcattagagtgcaaaaaatgac--agagaattaggcgactgatcataaaa--aactaaagttttatatgatcacgactcaagttatcatgttgatcc 25731409  T
112 ctacacttattcgattatcgaaagaaatgctgaactttgactttgacaaaatca 165  Q
     |||||||||||| |||  ||||| |||||  | ||||||||||||||||||||    
25731410 gtacacttattcggttactgaaaggaatgccaacctttgactttgacaaaatca 25731463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 171 - 257
Target Start/End: Original strand, 25731707 - 25731792
Alignment:
171 cattcgtctaaaatgcataatcaactggtagccacaaacacggccaattttgttgcatgaaaggcgattaaccaccacagaagaatt 257  Q
    ||||| ||||||||| |||||||| ||||||||||||||||| ||| ||||||||| ||||||| ||||||||||||||||||||||    
25731707 cattcttctaaaatg-ataatcaaatggtagccacaaacacgaccatttttgttgcgtgaaaggtgattaaccaccacagaagaatt 25731792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 154 - 245
Target Start/End: Complemental strand, 45300362 - 45300271
Alignment:
154 ttgacaaaatcaccaaccattcgtctaaaatgcataatcaactggtagccacaaacacggccaattttgttgcatgaaaggcgattaaccac 245  Q
    |||||||||| ||||| ||||  ||||  ||||||||||||||||||||||  |||| | ||| ||||||||| ||||||||||||||||||    
45300362 ttgacaaaattaccaagcattattctattatgcataatcaactggtagccattaacatgcccatttttgttgcctgaaaggcgattaaccac 45300271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98564 times since January 2019
Visitors: 2275