View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9091J-LTR4-TNT-insertion-2 (Length: 343)

Name: F9091J-LTR4-TNT-insertion-2
Description: F9091J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9091J-LTR4-TNT-insertion-2
F9091J-LTR4-TNT-insertion-2
[»] chr6 (6 HSPs)
chr6 (9-335)||(10814123-10814449)
chr6 (267-333)||(10821506-10821572)
chr6 (267-335)||(4312795-4312863)
chr6 (263-334)||(11703725-11703797)
chr6 (262-334)||(29032408-29032481)
chr6 (283-332)||(18614922-18614970)
[»] chr3 (18 HSPs)
chr3 (264-335)||(14426867-14426938)
chr3 (265-333)||(4767319-4767387)
chr3 (262-335)||(5554610-5554683)
chr3 (265-333)||(13291322-13291390)
chr3 (265-335)||(17637130-17637201)
chr3 (263-333)||(38075985-38076056)
chr3 (265-335)||(9796575-9796646)
chr3 (265-335)||(13340386-13340456)
chr3 (279-329)||(17119438-17119488)
chr3 (262-335)||(20311321-20311395)
chr3 (263-335)||(23953594-23953666)
chr3 (266-335)||(17034102-17034173)
chr3 (265-333)||(30212539-30212607)
chr3 (265-335)||(13177486-13177556)
chr3 (283-332)||(46349433-46349482)
chr3 (265-309)||(9258589-9258633)
chr3 (295-335)||(9323993-9324033)
chr3 (283-335)||(16198648-16198700)
[»] chr5 (6 HSPs)
chr5 (263-335)||(24492048-24492120)
chr5 (264-335)||(16182697-16182768)
chr5 (264-332)||(25935898-25935967)
chr5 (265-333)||(26014176-26014244)
chr5 (265-335)||(26335193-26335264)
chr5 (265-334)||(9824691-9824759)
[»] chr7 (12 HSPs)
chr7 (262-333)||(8106061-8106132)
chr7 (262-335)||(32957996-32958069)
chr7 (264-335)||(26822699-26822771)
chr7 (271-333)||(27706944-27707006)
chr7 (263-335)||(7185241-7185312)
chr7 (264-335)||(19143975-19144046)
chr7 (264-335)||(20743374-20743445)
chr7 (265-334)||(12341707-12341777)
chr7 (264-333)||(17891016-17891085)
chr7 (264-317)||(1775233-1775286)
chr7 (265-334)||(19142361-19142430)
chr7 (265-334)||(20741760-20741829)
[»] chr1 (14 HSPs)
chr1 (265-335)||(15650711-15650781)
chr1 (264-335)||(15787384-15787455)
chr1 (265-335)||(17496277-17496347)
chr1 (267-333)||(33439333-33439399)
chr1 (269-334)||(12398169-12398234)
chr1 (267-317)||(12668675-12668725)
chr1 (263-335)||(31583989-31584062)
chr1 (264-335)||(10751559-10751631)
chr1 (274-334)||(22666700-22666760)
chr1 (264-333)||(14580307-14580377)
chr1 (265-323)||(17316045-17316103)
chr1 (264-334)||(19018735-19018805)
chr1 (267-334)||(17103012-17103080)
chr1 (283-333)||(37282943-37282993)
[»] chr4 (13 HSPs)
chr4 (264-335)||(20896751-20896822)
chr4 (265-334)||(8677194-8677263)
chr4 (266-335)||(11420130-11420199)
chr4 (265-335)||(20245767-20245838)
chr4 (265-335)||(21809599-21809669)
chr4 (273-330)||(47576047-47576104)
chr4 (283-331)||(22222325-22222373)
chr4 (265-335)||(11449072-11449142)
chr4 (267-317)||(19053637-19053687)
chr4 (264-335)||(22316325-22316396)
chr4 (286-335)||(8912086-8912135)
chr4 (265-333)||(17473719-17473788)
chr4 (283-334)||(21587945-21587994)
[»] chr2 (14 HSPs)
chr2 (265-335)||(21547870-21547940)
chr2 (262-335)||(21585053-21585126)
chr2 (264-334)||(16586557-16586627)
chr2 (265-335)||(18848763-18848833)
chr2 (283-335)||(22311200-22311252)
chr2 (265-335)||(26654308-26654378)
chr2 (264-333)||(29410080-29410149)
chr2 (283-335)||(27765297-27765349)
chr2 (264-335)||(42256603-42256675)
chr2 (282-336)||(17417077-17417131)
chr2 (282-331)||(19877711-19877760)
chr2 (286-335)||(26652786-26652835)
chr2 (265-318)||(20586921-20586976)
chr2 (283-335)||(25916196-25916248)
[»] chr8 (10 HSPs)
chr8 (271-335)||(24308520-24308584)
chr8 (263-309)||(23584545-23584591)
chr8 (264-334)||(27118255-27118325)
chr8 (268-335)||(28890697-28890764)
chr8 (263-335)||(13303553-13303626)
chr8 (264-337)||(13645711-13645784)
chr8 (264-337)||(13746136-13746209)
chr8 (283-335)||(24502364-24502416)
chr8 (264-335)||(24276820-24276891)
chr8 (264-333)||(18527742-18527812)
[»] scaffold0053 (1 HSPs)
scaffold0053 (264-335)||(28327-28398)
[»] scaffold0161 (1 HSPs)
scaffold0161 (265-334)||(5495-5563)
[»] scaffold0023 (1 HSPs)
scaffold0023 (283-334)||(109262-109313)
[»] scaffold0804 (1 HSPs)
scaffold0804 (267-333)||(27-94)
[»] scaffold0754 (1 HSPs)
scaffold0754 (283-318)||(4953-4988)
[»] scaffold0002 (1 HSPs)
scaffold0002 (265-335)||(129432-129502)


Alignment Details
Target: chr6 (Bit Score: 323; Significance: 0; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 9 - 335
Target Start/End: Original strand, 10814123 - 10814449
Alignment:
9 cagtcagtgctaatgcaagcctctttgtaactggctggttcttgagctctgattattaaggctaatgtaaacttttgtgaatggagcaatgatagtctaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10814123 cagtcagtgctaatgcaagcctctttgtaactggctggttcttgagctctgattattaaggctaatgtaaacttttgtgaatggagcaatgatagtctaa 10814222  T
109 catatgtggaggaggttgtctggttctgctagaatatttatgtggctcaaatgaaggtaatgctatagaaattgtatcaatagagggaatagtatcaata 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10814223 catatgtggaggaggttgtctggttctgctagaatatttatgtggctcaaatgaaggtaatgctatagaaattgtatcaatagagggaatagtatcaata 10814322  T
209 ggtgggtaagtgatgagagaaatagatgtctcaggacattgaagagtggtatcatttgttggaacaaaattggtttgtacaattcctctaaggttttgat 308  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
10814323 ggtgggtaagtgatgagagaaatagatgtctcaggacattgaagagtggtttcatttgttggaacaaaattggtttgtacaattcctctaaggttttgat 10814422  T
309 ggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||||||||||||||    
10814423 ggtaacaaagaattaaagaacaattgg 10814449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 267 - 333
Target Start/End: Complemental strand, 10821572 - 10821506
Alignment:
267 ttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    |||||||||| | ||||||||||||| || ||||||||||||| |||||||| ||| ||||||||||    
10821572 ttggaacaaagtaggtttgtacaattactataaggttttgatgataacaaagtattgaagaacaatt 10821506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 267 - 335
Target Start/End: Complemental strand, 4312863 - 4312795
Alignment:
267 ttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||| |||||||||||||||||||| |||||| |||||||||  ||||||  |||||| |||||||||    
4312863 ttggatcaaaattggtttgtacaatttctctaaagttttgatgacaacaaaacattaaataacaattgg 4312795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 263 - 334
Target Start/End: Original strand, 11703725 - 11703797
Alignment:
263 tttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaac-aaagaattaaagaacaattg 334  Q
    ||||||| ||||||||| |||||||||||| |||||| ||||||||| |||| |||| |||| ||||||||||    
11703725 tttgttgaaacaaaattagtttgtacaattgctctaaagttttgatgataacaaaagtattatagaacaattg 11703797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 262 - 334
Target Start/End: Complemental strand, 29032481 - 29032408
Alignment:
262 atttgttggaacaaaattgg-tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    ||||| |||||||||||||| |||||| ||  ||||||  ||||||||| |||||||| |||||||||||||||    
29032481 atttgctggaacaaaattggatttgtataacacctctagagttttgatgataacaaagtattaaagaacaattg 29032408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 332
Target Start/End: Original strand, 18614922 - 18614970
Alignment:
283 ttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaat 332  Q
    |||||||||||||||| |||||||||| |||||||| ||| |||||||||    
18614922 ttgtacaattcctcta-ggttttgatgataacaaagtattgaagaacaat 18614970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 18)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 264 - 335
Target Start/End: Original strand, 14426867 - 14426938
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||    
14426867 ttgttggaacaaaattggtttgtacaattcctctaagattttgatgataacaaagtattaaagaacaattgg 14426938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 265 - 333
Target Start/End: Original strand, 4767319 - 4767387
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    ||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||    
4767319 tgttgaaacaaaattggtttgtacaattcctctaaggttttgatgataacaaagtattaaagaataatt 4767387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 262 - 335
Target Start/End: Original strand, 5554610 - 5554683
Alignment:
262 atttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||| |||||| |||||||||||||||||||||||||| |||||||| |||||||  ||||||||||||||||    
5554610 atttgatggaactaaattggtttgtacaattcctctaagtttttgatgataacaaaatattaaagaacaattgg 5554683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 265 - 333
Target Start/End: Original strand, 13291322 - 13291390
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    ||||||||||||||||||||||||||||||||||  | ||||||  |||||||| ||| ||||||||||    
13291322 tgttggaacaaaattggtttgtacaattcctctagagatttgataataacaaagtattgaagaacaatt 13291390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 265 - 335
Target Start/End: Original strand, 17637130 - 17637201
Alignment:
265 tgttggaacaaaattggttt-gtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||||||| ||||||||||||||  ||||||||| |||||||  | ||||||||||||||    
17637130 tgttggaacaaaattggttttgtacaattcctctagtgttttgatgataacaaattagtaaagaacaattgg 17637201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 263 - 333
Target Start/End: Original strand, 38075985 - 38076056
Alignment:
263 tttgttggaacaaaattggttt-gtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    |||||||||||||||||| ||| |||||||||||||||| ||||||||  ||||||| ||| ||||||||||    
38075985 tttgttggaacaaaattgattttgtacaattcctctaagattttgatgacaacaaagtattgaagaacaatt 38076056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 265 - 335
Target Start/End: Complemental strand, 9796646 - 9796575
Alignment:
265 tgttggaacaaaattggttt-gtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||| ||| |||||||| |||| | ||||||||| ||| |||| ||||||||||||||||    
9796646 tgttggaacaaaattgattttgtacaatttctctgaagttttgatgataataaagtattaaagaacaattgg 9796575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 335
Target Start/End: Original strand, 13340386 - 13340456
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||| |||||| | |||||  ||||| |||||||||||||||||| |||||||| ||| ||||||||||||    
13340386 tgttagaacaacaatggttcatacaagtcctctaaggttttgatgataacaaagtattgaagaacaattgg 13340456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 279 - 329
Target Start/End: Complemental strand, 17119488 - 17119438
Alignment:
279 tggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaac 329  Q
    ||||||||||||||||| ||||||||| ||| |||||||| ||||||||||    
17119488 tggtttgtacaattcctataaggtttttatgataacaaagtattaaagaac 17119438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 262 - 335
Target Start/End: Original strand, 20311321 - 20311395
Alignment:
262 atttgttggaacaaaattggttt-gtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||| ||||||||| |||| ||| ||||||||||  ||||||||| |||||||| ||| ||||||||||||    
20311321 atttgttgaaacaaaatttgttttgtataattcctctagagttttgatgataacaaagtatttaagaacaattgg 20311395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 263 - 335
Target Start/End: Original strand, 23953594 - 23953666
Alignment:
263 tttgttggaacaaaattggttt-gtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||| |||||||||| ||| |||||| ||||| ||| |||||||| |||||||| ||||||||||||||||    
23953594 tttgttgaaacaaaattgattttgtacaaatcctcaaag-ttttgatgataacaaagtattaaagaacaattgg 23953666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 266 - 335
Target Start/End: Original strand, 17034102 - 17034173
Alignment:
266 gttggaacaaaattggttt--gtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||||||  ||||||| ||||| | ||||||||| |||||| | ||| ||||||||||||    
17034102 gttggaacaaaattggtttttgtacaatgcctctgaagttttgatgataacaatgtattgaagaacaattgg 17034173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 333
Target Start/End: Complemental strand, 30212607 - 30212539
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    ||||||||||||| | ||||||| ||||||||||  ||||||||| ||| |||| ||||| ||||||||    
30212607 tgttggaacaaaaatagtttgtataattcctctagagttttgatgataataaagtattaacgaacaatt 30212539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 335
Target Start/End: Original strand, 13177486 - 13177556
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||| |||||| | |||||  ||||| |||||||||||||||||| ||| |||| ||| ||||||||||||    
13177486 tgttagaacaacaatggttcatacaagtcctctaaggttttgatgataaaaaagtattgaagaacaattgg 13177556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 332
Target Start/End: Complemental strand, 46349482 - 46349433
Alignment:
283 ttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaat 332  Q
    ||||||||||| |||||| |||||||| |||||||| ||| |||||||||    
46349482 ttgtacaattcttctaagattttgatgataacaaagtattgaagaacaat 46349433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 265 - 309
Target Start/End: Original strand, 9258589 - 9258633
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatg 309  Q
    |||| |||||||||||||| ||||||||||||||| | |||||||    
9258589 tgtttgaacaaaattggttggtacaattcctctaaagatttgatg 9258633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 335
Target Start/End: Complemental strand, 9324033 - 9323993
Alignment:
295 tctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||||| |||||||| ||| ||||||||||||    
9324033 tctaaggttttgatgataacaaagtattgaagaacaattgg 9323993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 335
Target Start/End: Original strand, 16198648 - 16198700
Alignment:
283 ttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||| |||||||||||| || |||||||| ||| ||||| ||||||    
16198648 ttgtacaattcatctaaggttttgttgataacaaagtattgaagaataattgg 16198700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 9e-24; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 263 - 335
Target Start/End: Original strand, 24492048 - 24492120
Alignment:
263 tttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||||    
24492048 tttgttggaacaaaagtggtttgtacaattcctctaaggttttgatgataacaaagtattgaagaacaattgg 24492120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 264 - 335
Target Start/End: Complemental strand, 16182768 - 16182697
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||||||||||| |||| |||||  ||||||||| |||||||| ||||||||| ||||||    
16182768 ttgttggaacaaaattggtttgtataatttctctagagttttgatgataacaaagtattaaagaataattgg 16182697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 264 - 332
Target Start/End: Original strand, 25935898 - 25935967
Alignment:
264 ttgttggaacaaaattgg-tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaat 332  Q
    |||||||||||||||||| |||||||| | ||||||||||||||||| || ||||  |||||||||||||    
25935898 ttgttggaacaaaattggatttgtacagtacctctaaggttttgatgatagcaaactattaaagaacaat 25935967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 265 - 333
Target Start/End: Complemental strand, 26014244 - 26014176
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    |||||||| ||| |||| ||||||||||| ||||||||||||| | |||||||  ||||||||||||||    
26014244 tgttggaataaatttgggttgtacaattcttctaaggttttgacgataacaaaatattaaagaacaatt 26014176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 265 - 335
Target Start/End: Original strand, 26335193 - 26335264
Alignment:
265 tgttggaacaaaattgg-tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||||||| ||| |||||| ||| ||| ||||||||| |||||||  ||||||||||||||||    
26335193 tgttggaacaaaattggatttatacaatgcctataaagttttgatgataacaaattattaaagaacaattgg 26335264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 265 - 334
Target Start/End: Complemental strand, 9824759 - 9824691
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    |||| |||||||| |||||  ||||||||||||| |||||||||| |||||||| ||| |||||||||||    
9824759 tgttagaacaaaaatggttcatacaattcctcta-ggttttgatgataacaaagtattgaagaacaattg 9824691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 56; Significance: 4e-23; HSPs: 12)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 262 - 333
Target Start/End: Complemental strand, 8106132 - 8106061
Alignment:
262 atttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| ||||||||| ||||    
8106132 atttgttggaacaaaattggtttgtacaattcctctagggttttgatgataacaaagtattaaagaataatt 8106061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 262 - 335
Target Start/End: Complemental strand, 32958069 - 32957996
Alignment:
262 atttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||||| ||||||||||||||||||||||  |||||||| ||| |||  ||||||||||||||||    
32958069 atttgttggaacaaatttggtttgtacaattcctctaaaattttgatgataataaaatattaaagaacaattgg 32957996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 264 - 335
Target Start/End: Complemental strand, 26822771 - 26822699
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaatt-aaagaacaattgg 335  Q
    ||||| |||||||||||||||||||||||| ||||||||||||||  |||||||| ||| |||||||||||||    
26822771 ttgttcgaacaaaattggtttgtacaattcatctaaggttttgataataacaaagtattaaaagaacaattgg 26822699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 271 - 333
Target Start/End: Original strand, 27706944 - 27707006
Alignment:
271 aacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    ||||||||||||||||||| ||| | |||||||||||||||||||||| ||||||||| ||||    
27706944 aacaaaattggtttgtacatttcttttaaggttttgatggtaacaaagtattaaagaataatt 27707006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 263 - 335
Target Start/End: Original strand, 7185241 - 7185312
Alignment:
263 tttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||| |||||||||||||||||||||||| ||||||| ||||||| |||||||| ||| ||| ||||||||    
7185241 tttgttagaacaaaattggtttgtacaattcatctaagg-tttgatgataacaaagtattgaaggacaattgg 7185312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 264 - 335
Target Start/End: Complemental strand, 19144046 - 19143975
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||| |||||||||| |||| |||| |||| ||| |||||||| |||||| |||||||||    
19144046 ttgttggaacaaaatttgtttgtacaactcctataagttttttatgataacaaagtattaaataacaattgg 19143975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 264 - 335
Target Start/End: Complemental strand, 20743445 - 20743374
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||| |||||||||| |||| |||| |||| ||| |||||||| |||||| |||||||||    
20743445 ttgttggaacaaaatttgtttgtacaactcctataagttttttatgataacaaagtattaaataacaattgg 20743374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 265 - 334
Target Start/End: Complemental strand, 12341777 - 12341707
Alignment:
265 tgttggaacaaaattgg-tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    ||||||||||||||||| |||||||||| |||||||  |||||||| |||||||| ||||||||| |||||    
12341777 tgttggaacaaaattggatttgtacaatgcctctaaaattttgatgataacaaagtattaaagaaaaattg 12341707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 264 - 333
Target Start/End: Original strand, 17891016 - 17891085
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    ||||||||||||||||  |||||| ||||||||||  ||||||||| |||||||  ||||||||||||||    
17891016 ttgttggaacaaaatttatttgtataattcctctagagttttgatgataacaaaatattaaagaacaatt 17891085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 317
Target Start/End: Original strand, 1775233 - 1775286
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaa 317  Q
    ||||| |||||||||||| |||||||||| || || |||||||||| |||||||    
1775233 ttgtttgaacaaaattggattgtacaatttctttacggttttgatgataacaaa 1775286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 334
Target Start/End: Original strand, 19142361 - 19142430
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    ||||||||||| | |||||   | |||||||||| | |||||||| |||||||| |||||||||||||||    
19142361 tgttggaacaagaatggttcaaataattcctctaggattttgatgataacaaagtattaaagaacaattg 19142430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 334
Target Start/End: Original strand, 20741760 - 20741829
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    ||||||||||| | |||||   | |||||||||| | |||||||| |||||||| |||||||||||||||    
20741760 tgttggaacaagaatggttcaaataattcctctaggattttgatgataacaaagtattaaagaacaattg 20741829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 14)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 265 - 335
Target Start/End: Original strand, 15650711 - 15650781
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||| ||||||||||||    
15650711 tgttggaacaaaattggtttgtacaattcctctaaggttttgatgataataaagtattgaagaacaattgg 15650781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 264 - 335
Target Start/End: Original strand, 15787384 - 15787455
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||| | ||||||||||    
15787384 ttgttggaacaaaattgatttgtacaattcctctaaggttttgatgataacaaagtattgacgaacaattgg 15787455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 265 - 335
Target Start/End: Original strand, 17496277 - 17496347
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||||||||| ||||| |||||| ||||||||  |||||||| ||| ||||||||||||    
17496277 tgttggaacaaaattggtttgtgcaatttctctaatgttttgataataacaaagtattgaagaacaattgg 17496347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 267 - 333
Target Start/End: Complemental strand, 33439399 - 33439333
Alignment:
267 ttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    ||||||||||||||||||||||||||||||||   |||||||| |||||| | ||||||||||||||    
33439399 ttggaacaaaattggtttgtacaattcctctagaattttgatgataacaaggtattaaagaacaatt 33439333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 269 - 334
Target Start/End: Complemental strand, 12398234 - 12398169
Alignment:
269 ggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    ||||||||||||||||||||||||||||||| ||||||||| ||| |||| ||| ||||| |||||    
12398234 ggaacaaaattggtttgtacaattcctctaaagttttgatgataataaagtattgaagaataattg 12398169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 267 - 317
Target Start/End: Original strand, 12668675 - 12668725
Alignment:
267 ttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaa 317  Q
    |||||| |||||||||||||||||||||||||||||||| ||| |||||||    
12668675 ttggaataaaattggtttgtacaattcctctaaggttttaatgataacaaa 12668725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 263 - 335
Target Start/End: Original strand, 31583989 - 31584062
Alignment:
263 tttgttggaacaaaattgg-tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||||||||| |||||||||| ||||| | ||||||||| |||||||| ||| ||||| ||||||    
31583989 tttgttggaacaaaattggttttgtacaatgcctctgatgttttgatgataacaaagtattgaagaataattgg 31584062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 264 - 335
Target Start/End: Complemental strand, 10751631 - 10751559
Alignment:
264 ttgttggaacaaaattgg-tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||| ||||||||| | ||||||||||  |||||| ||||||||| |||||||| ||||||||||||||||    
10751631 ttgttgaaacaaaatttgatttgtacaatgtctctaaagttttgatgataacaaagtattaaagaacaattgg 10751559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 274 - 334
Target Start/End: Complemental strand, 22666760 - 22666700
Alignment:
274 aaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    ||||||||||||||||||| |||||||| ||||||| ||| |||  |||||||||||||||    
22666760 aaaattggtttgtacaatttctctaaggatttgatgataataaattattaaagaacaattg 22666700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 264 - 333
Target Start/End: Original strand, 14580307 - 14580377
Alignment:
264 ttgttggaacaaaattgg-tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    |||||||||||||||||| ||||| |||| ||| |||  |||||||| |||||||| ||||||||||||||    
14580307 ttgttggaacaaaattggatttgtccaatgcctttaaaattttgatgataacaaagtattaaagaacaatt 14580377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 323
Target Start/End: Original strand, 17316045 - 17316103
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaatta 323  Q
    |||||||||||||| |||||||||||||| | ||||||||||| | |||||||| ||||    
17316045 tgttggaacaaaatcggtttgtacaattcttttaaggttttgacgataacaaagtatta 17316103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 264 - 334
Target Start/End: Original strand, 19018735 - 19018805
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    |||||| ||||||||||||||| |||||||| |||| ||||||||| ||| |||| ||| |||| ||||||    
19018735 ttgttgaaacaaaattggtttgcacaattccactaaagttttgatgataataaagtattgaagagcaattg 19018805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 267 - 334
Target Start/End: Original strand, 17103012 - 17103080
Alignment:
267 ttggaacaaaattggttt-gtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    ||||||||||| |||||| ||||||||||||| | ||||||||| |||||||  |||||||| ||||||    
17103012 ttggaacaaaaatggttttgtacaattcctctgaagttttgatgataacaaaatattaaagagcaattg 17103080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 333
Target Start/End: Original strand, 37282943 - 37282993
Alignment:
283 ttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    ||||||||||||||||| ||||||||| |||||||| ||| ||||| ||||    
37282943 ttgtacaattcctctaaagttttgatgataacaaagtatttaagaaaaatt 37282993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 52; Significance: 9e-21; HSPs: 13)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 264 - 335
Target Start/End: Original strand, 20896751 - 20896822
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||| |||||||||||||||||||||||||||||| |||||||| ||| |||| ||||||||||||||||    
20896751 ttgttgaaacaaaattggtttgtacaattcctctaagattttgatgataataaagtattaaagaacaattgg 20896822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 265 - 334
Target Start/End: Original strand, 8677194 - 8677263
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    ||||||||||||||||||||||||||||||||||  ||||||||| |||||||| |||||| ||||||||    
8677194 tgttggaacaaaattggtttgtacaattcctctagagttttgatgataacaaagtattaaaaaacaattg 8677263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 266 - 335
Target Start/End: Complemental strand, 11420199 - 11420130
Alignment:
266 gttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||||  |||||||||||||||||||||||||||| |||||||  ||||||||||||||||    
11420199 gttggaacaaaattaatttgtacaattcctctaaggttttgatgataacaaaatattaaagaacaattgg 11420130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 265 - 335
Target Start/End: Complemental strand, 20245838 - 20245767
Alignment:
265 tgttggaacaaaattgg-tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||||||| |||||||||| ||||| | ||||||||| |||||||| ||| ||||||||||||    
20245838 tgttggaacaaaattggatttgtacaatgcctctgatgttttgatgataacaaagtattgaagaacaattgg 20245767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 265 - 335
Target Start/End: Original strand, 21809599 - 21809669
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||| |||| ||||||||||||||||| |||| |||||||| |||||||  |||||| |||||||||    
21809599 tgttggaataaaagtggtttgtacaattcctataagattttgatgataacaaaatattaaaaaacaattgg 21809669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 273 - 330
Target Start/End: Complemental strand, 47576104 - 47576047
Alignment:
273 caaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaaca 330  Q
    ||||||||||||||| |||||||||| | |||||||| |||||||| |||||||||||    
47576104 caaaattggtttgtataattcctctaggattttgatgataacaaagtattaaagaaca 47576047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 283 - 331
Target Start/End: Original strand, 22222325 - 22222373
Alignment:
283 ttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaa 331  Q
    ||||||||||||||||||||||||||| |||||||| ||| ||||||||    
22222325 ttgtacaattcctctaaggttttgatgataacaaagtattgaagaacaa 22222373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 335
Target Start/End: Original strand, 11449072 - 11449142
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||||||||||||||| || ||  ||||||||| ||||| |  ||| ||||||||||||    
11449072 tgttggaacaaaattggtttgtacaatttctttagagttttgatgataacacaatattgaagaacaattgg 11449142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 267 - 317
Target Start/End: Complemental strand, 19053687 - 19053637
Alignment:
267 ttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaa 317  Q
    |||||||||||||||||||| |||||||||||  ||||||||| |||||||    
19053687 ttggaacaaaattggtttgttcaattcctctagagttttgatgataacaaa 19053637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 264 - 335
Target Start/End: Original strand, 22316325 - 22316396
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||| |||||| | ||||| |||||| ||||||| | |||||||| |||||||| ||| ||||||||||||    
22316325 ttgttagaacaagaatggttcgtacaagtcctctaggattttgatgataacaaagtattgaagaacaattgg 22316396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 335
Target Start/End: Complemental strand, 8912135 - 8912086
Alignment:
286 tacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||| | |||||||| |||||||| ||| ||||||||||||    
8912135 tacaattcctctaggattttgatgataacaaagcattgaagaacaattgg 8912086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 333
Target Start/End: Original strand, 17473719 - 17473788
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaa-caaagaattaaagaacaatt 333  Q
    ||||| |||||||||||||||||||| || ||||| ||||||||| |||  |||| ||||||||| ||||    
17473719 tgttgaaacaaaattggtttgtacaaatcttctaaagttttgatgataataaaagtattaaagaaaaatt 17473788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 334
Target Start/End: Original strand, 21587945 - 21587994
Alignment:
283 ttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    |||||||||| ||||||| |||||||||  |||||| |||||||||||||||    
21587945 ttgtacaatttctctaagattttgatgg--acaaaggattaaagaacaattg 21587994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 14)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 265 - 335
Target Start/End: Original strand, 21547870 - 21547940
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||| ||||||||||||||||||||||||||||||| || ||||| ||| ||||||||||||    
21547870 tgttggaacaaaagtggtttgtacaattcctctaaggttttgatgataccaaagtattgaagaacaattgg 21547940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 262 - 335
Target Start/End: Complemental strand, 21585126 - 21585053
Alignment:
262 atttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||| ||||||||||||||||||||||||||||| | |||||||| ||| |||||| |||||    
21585126 atttgttggaacaaaagtggtttgtacaattcctctaaggttttgaggataacaaagtattgaagaacgattgg 21585053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 264 - 334
Target Start/End: Original strand, 16586557 - 16586627
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    ||||||||||||||||| ||| ||||||||||||||| |||||||| |||||||| |||||| || |||||    
16586557 ttgttggaacaaaattgatttatacaattcctctaagattttgatgataacaaagtattaaaaaagaattg 16586627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 265 - 335
Target Start/End: Complemental strand, 18848833 - 18848763
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||||||||||||||| |||||  ||||| ||| |||||||| ||| ||||||||||||    
18848833 tgttggaacaaaattggtttgtacaatttctctagagtttttatgataacaaagtattgaagaacaattgg 18848763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 283 - 335
Target Start/End: Original strand, 22311200 - 22311252
Alignment:
283 ttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||||||||||||||||| |||||||| ||| ||||||||||||    
22311200 ttgtacaattcctctaaggttttgatgataacaaagtattgaagaacaattgg 22311252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 265 - 335
Target Start/End: Original strand, 26654308 - 26654378
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||| | |||||  |||||||||||| ||||||||||| |||||||| ||| ||||||||||||    
26654308 tgttggaacaagagtggttcatacaattcctctgaggttttgatgataacaaagtattgaagaacaattgg 26654378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 264 - 333
Target Start/End: Complemental strand, 29410149 - 29410080
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    ||||||||||| |||||||||||||||||||||| |  |||||||| || ||||| ||| ||||||||||    
29410149 ttgttggaacataattggtttgtacaattcctctgaaattttgatgatagcaaagtattgaagaacaatt 29410080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 283 - 335
Target Start/End: Original strand, 27765297 - 27765349
Alignment:
283 ttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||||| |||||||| |||||||| ||||||||| ||||||    
27765297 ttgtacaattcctctaagattttgatgataacaaagtattaaagaataattgg 27765349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 264 - 335
Target Start/End: Complemental strand, 42256675 - 42256603
Alignment:
264 ttgttggaacaaaattgg-tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||||||||||||||  |||||||| | ||| ||| ||||||||| |||||||| ||||||||||||||||    
42256675 ttgttggaacaaaattgaatttgtacagtacctataaagttttgatgataacaaagtattaaagaacaattgg 42256603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 336
Target Start/End: Original strand, 17417077 - 17417131
Alignment:
282 tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattggt 336  Q
    |||||||||||||| ||| ||||||||| |||||||| ||| |||||||||||||    
17417077 tttgtacaattcctttaaagttttgatgataacaaagtattgaagaacaattggt 17417131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 331
Target Start/End: Original strand, 19877711 - 19877760
Alignment:
282 tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaa 331  Q
    |||||||||||| ||||| ||||||||| |||||||| ||||||||||||    
19877711 tttgtacaattcttctaacgttttgatgataacaaagtattaaagaacaa 19877760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 335
Target Start/End: Original strand, 26652786 - 26652835
Alignment:
286 tacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||| |||||||| ||||||| |||||||| ||| ||||||||||||    
26652786 tacaattactctaaggatttgatgataacaaagtattgaagaacaattgg 26652835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 265 - 318
Target Start/End: Original strand, 20586921 - 20586976
Alignment:
265 tgttggaacaaaattggtttgt--acaattcctctaaggttttgatggtaacaaag 318  Q
    ||||||| ||||||||||||||  |||||||||||| |||||||||| || |||||    
20586921 tgttggagcaaaattggtttgtgtacaattcctctatggttttgatgatagcaaag 20586976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 335
Target Start/End: Original strand, 25916196 - 25916248
Alignment:
283 ttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||| ||||||||||| ||||||||  |||||||| ||| ||||||||||||    
25916196 ttgtataattcctctaaagttttgatcataacaaagtattgaagaacaattgg 25916248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 49; Significance: 5e-19; HSPs: 10)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 271 - 335
Target Start/End: Original strand, 24308520 - 24308584
Alignment:
271 aacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||| |||||| || ||||||    
24308520 aacaaaattggtttgtacaattcctctaaggttttgatgataacaaagtattaaataaaaattgg 24308584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 263 - 309
Target Start/End: Original strand, 23584545 - 23584591
Alignment:
263 tttgttggaacaaaattggtttgtacaattcctctaaggttttgatg 309  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
23584545 tttgttggaacaaaattggtttgtacaattcctctaaggttttgatg 23584591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 264 - 334
Target Start/End: Original strand, 27118255 - 27118325
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    |||||||||||||||||| |||||||||| |||||||||||||||| ||| |||| ||| |||||||||||    
27118255 ttgttggaacaaaattggcttgtacaatttctctaaggttttgatgataagaaagtattgaagaacaattg 27118325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 268 - 335
Target Start/End: Complemental strand, 28890764 - 28890697
Alignment:
268 tggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||| |||||||||  ||||||||||||||||| |||||||| ||||||||| ||||||    
28890764 tggaacaaaattgatttgtacaacccctctaaggttttgatgataacaaagtattaaagaataattgg 28890697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 263 - 335
Target Start/End: Complemental strand, 13303626 - 13303553
Alignment:
263 tttgttggaacaaaattggt-ttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||||||| |  ||| ||||||||||||||||||||||||||| |||||||  ||| || |||||||||    
13303626 tttgttggaacaagaagggtcttgtacaattcctctaaggttttgatgataacaaaatattgaaaaacaattgg 13303553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 264 - 337
Target Start/End: Complemental strand, 13645784 - 13645711
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattggta 337  Q
    |||||||||||| | |||||  ||||||||||||| | |||||||| |||||||| ||| || |||||||||||    
13645784 ttgttggaacaagaatggttcatacaattcctctaggattttgatgataacaaagtattgaataacaattggta 13645711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 264 - 337
Target Start/End: Complemental strand, 13746209 - 13746136
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattggta 337  Q
    |||||||||||| | |||||  ||||||||||||| | |||||||| |||||||| ||| || |||||||||||    
13746209 ttgttggaacaagaatggttcatacaattcctctaggattttgatgataacaaagtattgaataacaattggta 13746136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 335
Target Start/End: Original strand, 24502364 - 24502416
Alignment:
283 ttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    ||||||||| ||||||| ||||||||| ||| |||| ||||||||||||||||    
24502364 ttgtacaatacctctaaagttttgatgataataaagtattaaagaacaattgg 24502416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 264 - 335
Target Start/End: Original strand, 24276820 - 24276891
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||| ||||||||||||| |||||||| ||||   ||||||||| |||||||| |||  |||||||||||    
24276820 ttgttgaaacaaaattggttagtacaatttctcttgagttttgatgataacaaagtattgtagaacaattgg 24276891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 264 - 333
Target Start/End: Original strand, 18527742 - 18527812
Alignment:
264 ttgttggaacaaaattgg-tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    |||||||||||||||||  |||||||||| ||||||| ||||||||  ||||||   ||||||||||||||    
18527742 ttgttggaacaaaattgcatttgtacaatacctctaaagttttgattataacaagatattaaagaacaatt 18527812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0053 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0053
Description:

Target: scaffold0053; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 264 - 335
Target Start/End: Complemental strand, 28398 - 28327
Alignment:
264 ttgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||||| ||||||| ||||||||||||||||||||||||||||||| |||||||  ||| |||| |||||||    
28398 ttgttgaaacaaaagtggtttgtacaattcctctaaggttttgatgataacaaaatattgaagatcaattgg 28327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0161 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0161
Description:

Target: scaffold0161; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 265 - 334
Target Start/End: Complemental strand, 5563 - 5495
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    ||||| ||||||||||| ||||||||||||||||  ||||||||| |||||||| |||||| ||||||||    
5563 tgttgtaacaaaattgggttgtacaattcctctagagttttgatgataacaaagtattaaa-aacaattg 5495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0023 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0023
Description:

Target: scaffold0023; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 283 - 334
Target Start/End: Complemental strand, 109313 - 109262
Alignment:
283 ttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattg 334  Q
    ||||||||||||||||||||||  ||| |||||||||| |||||||||||||    
109313 ttgtacaattcctctaaggtttaaatgataacaaagaagtaaagaacaattg 109262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0804 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0804
Description:

Target: scaffold0804; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 267 - 333
Target Start/End: Original strand, 27 - 94
Alignment:
267 ttggaacaaaattgg-tttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaatt 333  Q
    ||||||||||||||| ||||| |||| ||| |||  |||||||| |||||||| ||||||||||||||    
27 ttggaacaaaattggatttgtccaatgcctttaaaattttgatgataacaaagtattaaagaacaatt 94  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0754 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0754
Description:

Target: scaffold0754; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 283 - 318
Target Start/End: Complemental strand, 4988 - 4953
Alignment:
283 ttgtacaattcctctaaggttttgatggtaacaaag 318  Q
    ||||||||||||||||||||||||||| ||||||||    
4988 ttgtacaattcctctaaggttttgatgataacaaag 4953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 335
Target Start/End: Complemental strand, 129502 - 129432
Alignment:
265 tgttggaacaaaattggtttgtacaattcctctaaggttttgatggtaacaaagaattaaagaacaattgg 335  Q
    |||| |||||| | |||||  ||||| |||||||||||||||||| ||| |||| ||| ||||||||||||    
129502 tgttagaacaacaatggttcatacaagtcctctaaggttttgatgataaaaaagtattgaagaacaattgg 129432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93668 times since January 2019
Visitors: 2365