View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9091J-LTR4-TNT-insertion-4 (Length: 152)

Name: F9091J-LTR4-TNT-insertion-4
Description: F9091J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9091J-LTR4-TNT-insertion-4
F9091J-LTR4-TNT-insertion-4
[»] chr8 (1 HSPs)
chr8 (4-142)||(5461423-5461561)


Alignment Details
Target: chr8 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 4 - 142
Target Start/End: Complemental strand, 5461561 - 5461423
Alignment:
4 aacacgttcaaccaccgcgcacaccgaaaacagacagccgagagttcaaggaactcatgaagctggacctagtagaattagacatgttacacttggttag 103  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5461561 aacaagttcaaccaccgcgcacaccgaaaacagacagccgagagttcaaggaactcatgaagctggacctagtagaattagacatgttacacttggttag 5461462  T
104 caatgtcagccattactgattattcacataacatcatta 142  Q
    |||||||||||||||||||||||||||||||||||||||    
5461461 caatgtcagccattactgattattcacataacatcatta 5461423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC