View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9091J-LTR4-TNT-insertion-6 (Length: 575)

Name: F9091J-LTR4-TNT-insertion-6
Description: F9091J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9091J-LTR4-TNT-insertion-6
F9091J-LTR4-TNT-insertion-6
[»] chr5 (2 HSPs)
chr5 (8-567)||(29305396-29305955)
chr5 (18-232)||(29297000-29297218)


Alignment Details
Target: chr5 (Bit Score: 487; Significance: 0; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 487; E-Value: 0
Query Start/End: Original strand, 8 - 567
Target Start/End: Complemental strand, 29305955 - 29305396
Alignment:
8 cctataaataataaataataagactctttttgtatttgatcactttggtggtagttacaagttcttgacaatgtttggcttcttttattgaattgtctgg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29305955 cctataaataataaataataagactctttttgtatttgatcactttggtggtagttacaagttcttgacaatgtttggcttcttttattgaattgtctgg 29305856  T
108 tccaacaaagcataataacataagaggttggcacaaaggaatagaactgtagcactttttggtgtctaaagtgaaatttttagtcacataataattgcat 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
29305855 tccaacaaagcataataacataagaggttggcacaaaggaatagaactgtagcactttctggtgtctaaagtgaaatttttagtcacataataattgcat 29305756  T
208 gatttttacttggtaattaccataatcattatatgatataggattcaaataacaaggttatttgactatattgaagcttcaaaaggcatgtattgacatc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29305755 gatttttacttggtaattaccataatcattatatgatataggattcaaataacaaggttatttgactatattgaagcttcaaaaggcatgtattgacatc 29305656  T
308 cacacccggtatattagattatgattcactattgtctcggcaagtttttacgcagtcaacccaatggtggtttttggatgatagtttaaattttaacgta 407  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||    
29305655 cacacacggtatattagattatgattcactattgtctcggcaagtttttacgcagtcaacacaatggtggtttttggatgatagtctaaattttaacgta 29305556  T
408 aattatgatgttttaaatatnnnnnnnnnnttaaatttgaaatctagattgttcaattttagtcaacggttattgtcgatatactgattgcatttcaatt 507  Q
    ||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29305555 aattatgatgttttaaatataaaaaaaaaattaaatttgaaatctagattgttcaattttagtcaacggttattgtcgatatactgattgcatttcaatt 29305456  T
508 gatgactnnnnnnnnntccaaatttgatcatcataaaaatttagaattttattgaaatta 567  Q
    |||||||         ||||||||||||||||||||||||||||||||||||||||||||    
29305455 gatgactaaaaaaaaatccaaatttgatcatcataaaaatttagaattttattgaaatta 29305396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 29297218 - 29297000
Alignment:
18 ataaataataagactctttttgtatttgatcactttggtggtagttacaagttcttgacaatgtt-------tggcttcttttattgaattgtctggtcc 110  Q
    |||||||| |||| |||||||||||||||||||||||||   ||||||||||| ||||| |||||       |||| ||||||||| |||||| ||||||    
29297218 ataaataagaagattctttttgtatttgatcactttggt---agttacaagttattgactatgttggctttgtggcatcttttattcaattgtatggtcc 29297122  T
111 aacaaagcataataacataagaggttggcacaaaggaatagaactgtagcactttttggtgtctaaagtgaaat-ttttagtcacataataattgcatga 209  Q
     | |||||||| ||  |||||||||||||| |||||||||||||||| ||||||| |||||| || |||||| | |||||| |||||||||||||||| |    
29297121 cataaagcata-tagtataagaggttggcaaaaaggaatagaactgtggcactttctggtgtgtacagtgaattattttaggcacataataattgcatta 29297023  T
210 tttttacttggtaattaccataa 232  Q
    | |||||||||||||||||||||    
29297022 tatttacttggtaattaccataa 29297000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105634 times since January 2019
Visitors: 2328