View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9091J-LTR4-TNT-insertion-6 (Length: 575)

Name: F9091J-LTR4-TNT-insertion-6
Description: F9091J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9091J-LTR4-TNT-insertion-6
[»] chr5 (2 HSPs)
chr5 (8-567)||(29305396-29305955)
chr5 (18-232)||(29297000-29297218)

Alignment Details
Target: chr5 (Bit Score: 487; Significance: 0; HSPs: 2)
Name: chr5

Target: chr5; HSP #1
Raw Score: 487; E-Value: 0
Query Start/End: Original strand, 8 - 567
Target Start/End: Complemental strand, 29305955 - 29305396
8 cctataaataataaataataagactctttttgtatttgatcactttggtggtagttacaagttcttgacaatgtttggcttcttttattgaattgtctgg 107  Q
29305955 cctataaataataaataataagactctttttgtatttgatcactttggtggtagttacaagttcttgacaatgtttggcttcttttattgaattgtctgg 29305856  T
108 tccaacaaagcataataacataagaggttggcacaaaggaatagaactgtagcactttttggtgtctaaagtgaaatttttagtcacataataattgcat 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
29305855 tccaacaaagcataataacataagaggttggcacaaaggaatagaactgtagcactttctggtgtctaaagtgaaatttttagtcacataataattgcat 29305756  T
208 gatttttacttggtaattaccataatcattatatgatataggattcaaataacaaggttatttgactatattgaagcttcaaaaggcatgtattgacatc 307  Q
29305755 gatttttacttggtaattaccataatcattatatgatataggattcaaataacaaggttatttgactatattgaagcttcaaaaggcatgtattgacatc 29305656  T
308 cacacccggtatattagattatgattcactattgtctcggcaagtttttacgcagtcaacccaatggtggtttttggatgatagtttaaattttaacgta 407  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||    
29305655 cacacacggtatattagattatgattcactattgtctcggcaagtttttacgcagtcaacacaatggtggtttttggatgatagtctaaattttaacgta 29305556  T
408 aattatgatgttttaaatatnnnnnnnnnnttaaatttgaaatctagattgttcaattttagtcaacggttattgtcgatatactgattgcatttcaatt 507  Q
    ||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29305555 aattatgatgttttaaatataaaaaaaaaattaaatttgaaatctagattgttcaattttagtcaacggttattgtcgatatactgattgcatttcaatt 29305456  T
508 gatgactnnnnnnnnntccaaatttgatcatcataaaaatttagaattttattgaaatta 567  Q
    |||||||         ||||||||||||||||||||||||||||||||||||||||||||    
29305455 gatgactaaaaaaaaatccaaatttgatcatcataaaaatttagaattttattgaaatta 29305396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 29297218 - 29297000
18 ataaataataagactctttttgtatttgatcactttggtggtagttacaagttcttgacaatgtt-------tggcttcttttattgaattgtctggtcc 110  Q
    |||||||| |||| |||||||||||||||||||||||||   ||||||||||| ||||| |||||       |||| ||||||||| |||||| ||||||    
29297218 ataaataagaagattctttttgtatttgatcactttggt---agttacaagttattgactatgttggctttgtggcatcttttattcaattgtatggtcc 29297122  T
111 aacaaagcataataacataagaggttggcacaaaggaatagaactgtagcactttttggtgtctaaagtgaaat-ttttagtcacataataattgcatga 209  Q
     | |||||||| ||  |||||||||||||| |||||||||||||||| ||||||| |||||| || |||||| | |||||| |||||||||||||||| |    
29297121 cataaagcata-tagtataagaggttggcaaaaaggaatagaactgtggcactttctggtgtgtacagtgaattattttaggcacataataattgcatta 29297023  T
210 tttttacttggtaattaccataa 232  Q
    | |||||||||||||||||||||    
29297022 tatttacttggtaattaccataa 29297000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC