View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9096J-LTR4-TNT-insertion-1 (Length: 238)

Name: F9096J-LTR4-TNT-insertion-1
Description: F9096J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9096J-LTR4-TNT-insertion-1
F9096J-LTR4-TNT-insertion-1
[»] chr8 (1 HSPs)
chr8 (10-229)||(7999053-7999272)


Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 229
Target Start/End: Original strand, 7999053 - 7999272
Alignment:
10 aaaagtacatataaataacagcaaaagtcagggaacagaaaagaatacgnnnnnnntcaagaaaaacctgcaacaagacggaattgctgcggctgttgaa 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||    
7999053 aaaagtacatataaataacagcaaaagtcagggaacagaaaagaatacgaaaaaaatcaagaaaaacctgcaacaagacggaattgctgcggctgttgaa 7999152  T
110 taggattattagcttttaatttcaaaattatcgtttaaaatgaaaattgaagggcattctgggtgtttcctagataaaaacatattgctttgtagtttca 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7999153 taggattattagcttttaatttcaaaattatcgtttaaaatgaaaattgaagggcattctgggtgtttcctagataaaaacatattgctttgtagtttca 7999252  T
210 gatgcacataggggcaattg 229  Q
    ||||||||||||||||||||    
7999253 gatgcacataggggcaattg 7999272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC