View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9096J-LTR4-TNT-insertion-2 (Length: 323)

Name: F9096J-LTR4-TNT-insertion-2
Description: F9096J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9096J-LTR4-TNT-insertion-2
F9096J-LTR4-TNT-insertion-2
[»] chr5 (3 HSPs)
chr5 (8-314)||(40088592-40088898)
chr5 (37-117)||(14378644-14378724)
chr5 (142-248)||(14378540-14378646)
[»] chr1 (1 HSPs)
chr1 (31-257)||(25467084-25467310)
[»] chr6 (5 HSPs)
chr6 (37-255)||(16720705-16720922)
chr6 (154-314)||(30948056-30948212)
chr6 (37-167)||(14011041-14011170)
chr6 (37-131)||(30948213-30948298)
chr6 (205-255)||(14011199-14011249)
[»] chr4 (2 HSPs)
chr4 (37-255)||(54187339-54187556)
chr4 (37-255)||(8571610-8571827)
[»] chr7 (1 HSPs)
chr7 (37-255)||(3366427-3366644)
[»] chr3 (1 HSPs)
chr3 (37-255)||(28697570-28697787)


Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 8 - 314
Target Start/End: Original strand, 40088592 - 40088898
Alignment:
8 agctccccaccctgtcaactgtcccaatgttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
40088592 agctccccaccctgtcaactgtcccaatgttcttaaaatcaactcaactagtgaagaagtgaataagcaataatacctgatcagcaagatcataaatcaa 40088691  T
108 ctttgagtcttctccatattttcccatgagagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctatt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40088692 ctttgagtcttctccatattttcccatgagagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctatt 40088791  T
208 actgaaaatactttctttcgaatggtcatttgttctttagcaaaatcacgcacgtgtcccctaatattgtcacattatgatactcaaggtaagactacca 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40088792 actgaaaatactttctttcgaatggtcatttgttctttagcaaaatcacgcacgtgtcccctaatattgtcacattatgatactcaaggtaagactacca 40088891  T
308 acaattg 314  Q
    |||||||    
40088892 acaattg 40088898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 37 - 117
Target Start/End: Complemental strand, 14378724 - 14378644
Alignment:
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtct 117  Q
    ||||||||||||||||||||||| |||||||||| |||||||||||||| |||||||| |||||||| |||||||||||||    
14378724 ttcttaaaatcaactcaactagtaaagaagtgaataagcaataataccttatcagcaatatcataaaccaactttgagtct 14378644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 142 - 248
Target Start/End: Complemental strand, 14378646 - 14378540
Alignment:
142 tctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcatttgtt 241  Q
    |||| ||||||||||||  |||||||||||  ||||||||| ||||||||||||| |||| |||||||||||||| | ||||||| ||| ||||||| ||    
14378646 tctctcaattcaaagacctgtgtatccaaggttgtggcgccatgcctctcaaaaacttctactattactgaaaatgcattctttctaatagtcatttttt 14378547  T
242 ctttagc 248  Q
    |||||||    
14378546 ctttagc 14378540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 31 - 257
Target Start/End: Original strand, 25467084 - 25467310
Alignment:
31 ccaatgttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttc 130  Q
    ||||| ||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25467084 ccaatattcttaaaatcaactcaactagtcaagaagtgaataagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttc 25467183  T
131 ccatgagagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaat 230  Q
    |||| |||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||| ||||||||||||||||||| ||||||||| |||    
25467184 ccataagagtttctcgcaattcaaagacaggtgtatccaaggctgtggcaccatgcctctcaaaaacttcttctattactgaaaatgctttctttctaat 25467283  T
231 ggtcatttgttctttagcaaaatcacg 257  Q
     ||||||||||||||||| ||||||||    
25467284 agtcatttgttctttagcgaaatcacg 25467310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 107; Significance: 1e-53; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 37 - 255
Target Start/End: Complemental strand, 16720922 - 16720705
Alignment:
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcccatga 136  Q
    ||||||||| ||||| || |||| |||||||||| || | |||| |||| |||||||| |||||||| ||||||||||  ||||||||||||||| ||||    
16720922 ttcttaaaa-caacttaagtagttaagaagtgaataaccgataaaaccttatcagcaatatcataaaccaactttgagatttctccatattttcctatga 16720824  T
137 gagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcat 236  Q
    ||| ||||| |||||||||||| ||||||||||||  ||||||||| ||||||||||||| |||| | |||||||||||| ||||||||| ||| |||||    
16720823 gagcttctctcaattcaaagaccggtgtatccaaggttgtggcgccatgcctctcaaaaacttctaccattactgaaaatgctttctttctaatagtcat 16720724  T
237 ttgttctttagcaaaatca 255  Q
    |||||||||||| ||||||    
16720723 ttgttctttagcgaaatca 16720705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 154 - 314
Target Start/End: Complemental strand, 30948212 - 30948056
Alignment:
154 aagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcatttgttctttagcaaaat 253  Q
    |||||||||||||||||| ||||||| || ||||||||||||| |||| || ||||| ||||| ||||||||| | | | ||||||||||||||||||||    
30948212 aagacaggtgtatccaaggctgtggcaccatgcctctcaaaaacttctactgttactcaaaatgctttctttctattagccatttgttctttagcaaaat 30948113  T
254 cacgcacgtgtcccctaatattgtcacattatgatactcaaggtaagactaccaacaattg 314  Q
        || ||| |||||  || ||||||||| ||||||||||||||| ||||||||||||||    
30948112 ----catgtgccccctggtactgtcacattgtgatactcaaggtaaaactaccaacaattg 30948056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 37 - 167
Target Start/End: Original strand, 14011041 - 14011170
Alignment:
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcccatga 136  Q
    ||||||||| ||||| || |||| |||||||||| || | |||| |||| |||||||| |||||||| ||||||||||  ||||||||||||||| ||||    
14011041 ttcttaaaa-caacttaagtagttaagaagtgaataaccgataaaaccttatcagcaatatcataaaccaactttgagatttctccatattttcctatga 14011139  T
137 gagtttctcgcaattcaaagacaggtgtatc 167  Q
    ||| ||||| |||||||||||| ||||||||    
14011140 gagcttctctcaattcaaagaccggtgtatc 14011170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 37 - 131
Target Start/End: Complemental strand, 30948298 - 30948213
Alignment:
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcc 131  Q
    |||||||||||||||||| |||| ||||| |||||||||||||||||||          ||||||||  ||||||||||||||||||||||||||    
30948298 ttcttaaaatcaactcaattagtcaagaactgaacaagcaataatacct---------tatcataaactaactttgagtcttctccatattttcc 30948213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 205 - 255
Target Start/End: Original strand, 14011199 - 14011249
Alignment:
205 attactgaaaatactttctttcgaatggtcatttgttctttagcaaaatca 255  Q
    |||||||||||| ||||||||| ||  ||||||||||||||||| ||||||    
14011199 attactgaaaatgctttctttctaaaagtcatttgttctttagcgaaatca 14011249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 37 - 255
Target Start/End: Original strand, 54187339 - 54187556
Alignment:
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcccatga 136  Q
    ||||||||| ||||| || |||| |||||||||| || | |||| |||| |||||||| |||||||| ||||||||||  ||||||||||||||| ||||    
54187339 ttcttaaaa-caacttaagtagttaagaagtgaataaccgataaaaccttatcagcaatatcataaaccaactttgagatttctccatattttcctatga 54187437  T
137 gagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcat 236  Q
    ||| ||||| |||||||||||| ||||||||||||  ||||||||| ||||||||||||| |||| | |||||||||||| ||||||||| ||| |||||    
54187438 gagcttctctcaattcaaagaccggtgtatccaaggttgtggcgccatgcctctcaaaaacttctaccattactgaaaatgctttctttctaatagtcat 54187537  T
237 ttgttctttagcaaaatca 255  Q
    |||||||||||| ||||||    
54187538 ttgttctttagcgaaatca 54187556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 37 - 255
Target Start/End: Complemental strand, 8571827 - 8571610
Alignment:
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcccatga 136  Q
    ||||||||| ||||| || |||| ||||||| || || | |||| |||| |||||||| |||||||| ||||||||||  ||||||||||||||| ||||    
8571827 ttcttaaaa-caacttaagtagttaagaagtaaataaccgataaaaccttatcagcaatatcataaaccaactttgagatttctccatattttcctatga 8571729  T
137 gagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcat 236  Q
    ||| ||||| |||||||||||||||||||| ||||  ||||||||| || |||||||||| |||| | |||||||||||| ||||||||| ||| |||||    
8571728 gagcttctctcaattcaaagacaggtgtatgcaaggttgtggcgccatgtctctcaaaaacttctaccattactgaaaatgctttctttctaatagtcat 8571629  T
237 ttgttctttagcaaaatca 255  Q
    |||||||||||| ||||||    
8571628 ttgttctttagcgaaatca 8571610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 37 - 255
Target Start/End: Original strand, 3366427 - 3366644
Alignment:
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcccatga 136  Q
    ||||||||| ||||| || |||| |||||||||| || | |||| |||| |||||||| |||||||| ||||||||||  ||||||||||||||| ||||    
3366427 ttcttaaaa-caacttaagtagttaagaagtgaataaccgataaaaccttatcagcaatatcataaaccaactttgagatttctccatattttcctatga 3366525  T
137 gagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcat 236  Q
    ||| ||||| |||||||||||| ||||||||||||  ||||| ||| ||||||||||||| |||| | |||||||||||| ||||||||| ||| |||||    
3366526 gagcttctctcaattcaaagaccggtgtatccaaggttgtggtgccatgcctctcaaaaacttctaccattactgaaaatgctttctttctaatagtcat 3366625  T
237 ttgttctttagcaaaatca 255  Q
    |||||||||||| ||||||    
3366626 ttgttctttagcgaaatca 3366644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 99; Significance: 7e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 37 - 255
Target Start/End: Complemental strand, 28697787 - 28697570
Alignment:
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcccatga 136  Q
    ||||||||| ||||| || |||| ||||||| || || | |||| |||| |||||||| |||||||| ||||||||||  ||||||||||||||| ||||    
28697787 ttcttaaaa-caacttaagtagttaagaagtaaataaccgataaaaccttatcagcaatatcataaaccaactttgagatttctccatattttcctatga 28697689  T
137 gagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcat 236  Q
    ||| ||||| |||||||||||||||||||| ||||  ||||||||| || |||||||||| |||| | |||||||||||| ||||||||| ||| |||||    
28697688 gagcttctctcaattcaaagacaggtgtatgcaaggttgtggcgccatgtctctcaaaaacttctaccattactgaaaatgctttctttctaatagtcat 28697589  T
237 ttgttctttagcaaaatca 255  Q
    |||||||||||| ||||||    
28697588 ttgttctttagcgaaatca 28697570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC