View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9096J-LTR4-TNT-insertion-2 (Length: 323)

Name: F9096J-LTR4-TNT-insertion-2
Description: F9096J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9096J-LTR4-TNT-insertion-2
[»] chr5 (3 HSPs)
chr5 (8-314)||(40088592-40088898)
chr5 (37-117)||(14378644-14378724)
chr5 (142-248)||(14378540-14378646)
[»] chr1 (1 HSPs)
chr1 (31-257)||(25467084-25467310)
[»] chr6 (5 HSPs)
chr6 (37-255)||(16720705-16720922)
chr6 (154-314)||(30948056-30948212)
chr6 (37-167)||(14011041-14011170)
chr6 (37-131)||(30948213-30948298)
chr6 (205-255)||(14011199-14011249)
[»] chr4 (2 HSPs)
chr4 (37-255)||(54187339-54187556)
chr4 (37-255)||(8571610-8571827)
[»] chr7 (1 HSPs)
chr7 (37-255)||(3366427-3366644)
[»] chr3 (1 HSPs)
chr3 (37-255)||(28697570-28697787)

Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 3)
Name: chr5

Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 8 - 314
Target Start/End: Original strand, 40088592 - 40088898
8 agctccccaccctgtcaactgtcccaatgttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
40088592 agctccccaccctgtcaactgtcccaatgttcttaaaatcaactcaactagtgaagaagtgaataagcaataatacctgatcagcaagatcataaatcaa 40088691  T
108 ctttgagtcttctccatattttcccatgagagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctatt 207  Q
40088692 ctttgagtcttctccatattttcccatgagagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctatt 40088791  T
208 actgaaaatactttctttcgaatggtcatttgttctttagcaaaatcacgcacgtgtcccctaatattgtcacattatgatactcaaggtaagactacca 307  Q
40088792 actgaaaatactttctttcgaatggtcatttgttctttagcaaaatcacgcacgtgtcccctaatattgtcacattatgatactcaaggtaagactacca 40088891  T
308 acaattg 314  Q
40088892 acaattg 40088898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 37 - 117
Target Start/End: Complemental strand, 14378724 - 14378644
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtct 117  Q
    ||||||||||||||||||||||| |||||||||| |||||||||||||| |||||||| |||||||| |||||||||||||    
14378724 ttcttaaaatcaactcaactagtaaagaagtgaataagcaataataccttatcagcaatatcataaaccaactttgagtct 14378644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 142 - 248
Target Start/End: Complemental strand, 14378646 - 14378540
142 tctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcatttgtt 241  Q
    |||| ||||||||||||  |||||||||||  ||||||||| ||||||||||||| |||| |||||||||||||| | ||||||| ||| ||||||| ||    
14378646 tctctcaattcaaagacctgtgtatccaaggttgtggcgccatgcctctcaaaaacttctactattactgaaaatgcattctttctaatagtcatttttt 14378547  T
242 ctttagc 248  Q
14378546 ctttagc 14378540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 31 - 257
Target Start/End: Original strand, 25467084 - 25467310
31 ccaatgttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttc 130  Q
    ||||| ||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25467084 ccaatattcttaaaatcaactcaactagtcaagaagtgaataagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttc 25467183  T
131 ccatgagagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaat 230  Q
    |||| |||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||| ||||||||||||||||||| ||||||||| |||    
25467184 ccataagagtttctcgcaattcaaagacaggtgtatccaaggctgtggcaccatgcctctcaaaaacttcttctattactgaaaatgctttctttctaat 25467283  T
231 ggtcatttgttctttagcaaaatcacg 257  Q
     ||||||||||||||||| ||||||||    
25467284 agtcatttgttctttagcgaaatcacg 25467310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 107; Significance: 1e-53; HSPs: 5)
Name: chr6

Target: chr6; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 37 - 255
Target Start/End: Complemental strand, 16720922 - 16720705
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcccatga 136  Q
    ||||||||| ||||| || |||| |||||||||| || | |||| |||| |||||||| |||||||| ||||||||||  ||||||||||||||| ||||    
16720922 ttcttaaaa-caacttaagtagttaagaagtgaataaccgataaaaccttatcagcaatatcataaaccaactttgagatttctccatattttcctatga 16720824  T
137 gagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcat 236  Q
    ||| ||||| |||||||||||| ||||||||||||  ||||||||| ||||||||||||| |||| | |||||||||||| ||||||||| ||| |||||    
16720823 gagcttctctcaattcaaagaccggtgtatccaaggttgtggcgccatgcctctcaaaaacttctaccattactgaaaatgctttctttctaatagtcat 16720724  T
237 ttgttctttagcaaaatca 255  Q
    |||||||||||| ||||||    
16720723 ttgttctttagcgaaatca 16720705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 154 - 314
Target Start/End: Complemental strand, 30948212 - 30948056
154 aagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcatttgttctttagcaaaat 253  Q
    |||||||||||||||||| ||||||| || ||||||||||||| |||| || ||||| ||||| ||||||||| | | | ||||||||||||||||||||    
30948212 aagacaggtgtatccaaggctgtggcaccatgcctctcaaaaacttctactgttactcaaaatgctttctttctattagccatttgttctttagcaaaat 30948113  T
254 cacgcacgtgtcccctaatattgtcacattatgatactcaaggtaagactaccaacaattg 314  Q
        || ||| |||||  || ||||||||| ||||||||||||||| ||||||||||||||    
30948112 ----catgtgccccctggtactgtcacattgtgatactcaaggtaaaactaccaacaattg 30948056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 37 - 167
Target Start/End: Original strand, 14011041 - 14011170
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcccatga 136  Q
    ||||||||| ||||| || |||| |||||||||| || | |||| |||| |||||||| |||||||| ||||||||||  ||||||||||||||| ||||    
14011041 ttcttaaaa-caacttaagtagttaagaagtgaataaccgataaaaccttatcagcaatatcataaaccaactttgagatttctccatattttcctatga 14011139  T
137 gagtttctcgcaattcaaagacaggtgtatc 167  Q
    ||| ||||| |||||||||||| ||||||||    
14011140 gagcttctctcaattcaaagaccggtgtatc 14011170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 37 - 131
Target Start/End: Complemental strand, 30948298 - 30948213
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcc 131  Q
    |||||||||||||||||| |||| ||||| |||||||||||||||||||          ||||||||  ||||||||||||||||||||||||||    
30948298 ttcttaaaatcaactcaattagtcaagaactgaacaagcaataatacct---------tatcataaactaactttgagtcttctccatattttcc 30948213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 205 - 255
Target Start/End: Original strand, 14011199 - 14011249
205 attactgaaaatactttctttcgaatggtcatttgttctttagcaaaatca 255  Q
    |||||||||||| ||||||||| ||  ||||||||||||||||| ||||||    
14011199 attactgaaaatgctttctttctaaaagtcatttgttctttagcgaaatca 14011249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4

Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 37 - 255
Target Start/End: Original strand, 54187339 - 54187556
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcccatga 136  Q
    ||||||||| ||||| || |||| |||||||||| || | |||| |||| |||||||| |||||||| ||||||||||  ||||||||||||||| ||||    
54187339 ttcttaaaa-caacttaagtagttaagaagtgaataaccgataaaaccttatcagcaatatcataaaccaactttgagatttctccatattttcctatga 54187437  T
137 gagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcat 236  Q
    ||| ||||| |||||||||||| ||||||||||||  ||||||||| ||||||||||||| |||| | |||||||||||| ||||||||| ||| |||||    
54187438 gagcttctctcaattcaaagaccggtgtatccaaggttgtggcgccatgcctctcaaaaacttctaccattactgaaaatgctttctttctaatagtcat 54187537  T
237 ttgttctttagcaaaatca 255  Q
    |||||||||||| ||||||    
54187538 ttgttctttagcgaaatca 54187556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 37 - 255
Target Start/End: Complemental strand, 8571827 - 8571610
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcccatga 136  Q
    ||||||||| ||||| || |||| ||||||| || || | |||| |||| |||||||| |||||||| ||||||||||  ||||||||||||||| ||||    
8571827 ttcttaaaa-caacttaagtagttaagaagtaaataaccgataaaaccttatcagcaatatcataaaccaactttgagatttctccatattttcctatga 8571729  T
137 gagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcat 236  Q
    ||| ||||| |||||||||||||||||||| ||||  ||||||||| || |||||||||| |||| | |||||||||||| ||||||||| ||| |||||    
8571728 gagcttctctcaattcaaagacaggtgtatgcaaggttgtggcgccatgtctctcaaaaacttctaccattactgaaaatgctttctttctaatagtcat 8571629  T
237 ttgttctttagcaaaatca 255  Q
    |||||||||||| ||||||    
8571628 ttgttctttagcgaaatca 8571610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 37 - 255
Target Start/End: Original strand, 3366427 - 3366644
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcccatga 136  Q
    ||||||||| ||||| || |||| |||||||||| || | |||| |||| |||||||| |||||||| ||||||||||  ||||||||||||||| ||||    
3366427 ttcttaaaa-caacttaagtagttaagaagtgaataaccgataaaaccttatcagcaatatcataaaccaactttgagatttctccatattttcctatga 3366525  T
137 gagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcat 236  Q
    ||| ||||| |||||||||||| ||||||||||||  ||||| ||| ||||||||||||| |||| | |||||||||||| ||||||||| ||| |||||    
3366526 gagcttctctcaattcaaagaccggtgtatccaaggttgtggtgccatgcctctcaaaaacttctaccattactgaaaatgctttctttctaatagtcat 3366625  T
237 ttgttctttagcaaaatca 255  Q
    |||||||||||| ||||||    
3366626 ttgttctttagcgaaatca 3366644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 99; Significance: 7e-49; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 37 - 255
Target Start/End: Complemental strand, 28697787 - 28697570
37 ttcttaaaatcaactcaactagtgaagaagtgaacaagcaataatacctgatcagcaagatcataaatcaactttgagtcttctccatattttcccatga 136  Q
    ||||||||| ||||| || |||| ||||||| || || | |||| |||| |||||||| |||||||| ||||||||||  ||||||||||||||| ||||    
28697787 ttcttaaaa-caacttaagtagttaagaagtaaataaccgataaaaccttatcagcaatatcataaaccaactttgagatttctccatattttcctatga 28697689  T
137 gagtttctcgcaattcaaagacaggtgtatccaagactgtggcgccgtgcctctcaaaaatttcttctattactgaaaatactttctttcgaatggtcat 236  Q
    ||| ||||| |||||||||||||||||||| ||||  ||||||||| || |||||||||| |||| | |||||||||||| ||||||||| ||| |||||    
28697688 gagcttctctcaattcaaagacaggtgtatgcaaggttgtggcgccatgtctctcaaaaacttctaccattactgaaaatgctttctttctaatagtcat 28697589  T
237 ttgttctttagcaaaatca 255  Q
    |||||||||||| ||||||    
28697588 ttgttctttagcgaaatca 28697570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 77722 times since January 2019
Visitors: 2276