View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9096J-LTR4-TNT-insertion-5 (Length: 572)

Name: F9096J-LTR4-TNT-insertion-5
Description: F9096J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9096J-LTR4-TNT-insertion-5
F9096J-LTR4-TNT-insertion-5
[»] chr5 (4 HSPs)
chr5 (10-562)||(32254851-32255403)
chr5 (26-470)||(32248674-32249123)
chr5 (30-213)||(32264213-32264396)
chr5 (311-420)||(32236485-32236595)
[»] chr1 (2 HSPs)
chr1 (226-391)||(23202952-23203119)
chr1 (481-563)||(23194011-23194092)


Alignment Details
Target: chr5 (Bit Score: 549; Significance: 0; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 549; E-Value: 0
Query Start/End: Original strand, 10 - 562
Target Start/End: Complemental strand, 32255403 - 32254851
Alignment:
10 cgtagcaccgcaacatccacgacgggaacaccatataacccagccaattccaatataaaaaaggccatacttgtggccactgacattgatgctcttgact 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32255403 cgtagcaccgcaacatccacgacgggaacaccatataacccagccaattccaatataaaaaaggccatacttgtggccactgacattgatgctcttgact 32255304  T
110 aatgggagtctaaagtcccactctagcatcttgtagggaaacgacgaagtaggtgcgtgaagatccatggtaacaggatacttagccatgtccacataaa 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32255303 aatgggagtctaaagtcccactctagcatcttgtagggaaacgacgaagtaggtgcgtgaagatccatggtaacaggatacttagccatgtccacataaa 32255204  T
210 ttttgcttattgattctaagtctattgcattcctcctccatgggaatcatgttcaactttgcaaatattagagtgcatggacatcagaagaaaaagatga 309  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
32255203 ttttgcttattgattctaagtctattgcattcctcctccatgggaatcatgttcaactttgcaaatattagagtgcatggacatcagaagaaaaagttga 32255104  T
310 catcctaattaagttgacacccaaaattcactacctatcatttgcaacaccctaacaaatttattgacataaagaaatacaataaaaatcttggaaggga 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32255103 catcctaattaagttgacacccaaaattcactacctatcatttgcaacaccctaacaaatttattgacataaagaaatacaataaaaatcttggaaggga 32255004  T
410 tagaccaaaacccaagaagtaggataaccgctcatgaagaaaaagagtgcaattcaataactagcaacaagaccaaactcaaaataaaacaactaaccat 509  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32255003 tagaccaaaacccaagaagtaggataaccgctcatgaagaaaaagagtgcaattcaataactagcaacaagaccaaactcaaaataaaacaactaaccat 32254904  T
510 catctaaatctataactttctaaagaagttttctttgatacaccttgatatta 562  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
32254903 catctaaatctataactttctaaagaagttttctttgatacaccttgatatta 32254851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 26 - 470
Target Start/End: Complemental strand, 32249123 - 32248674
Alignment:
26 ccacgacgggaacaccatataacccagccaattccaatataaaaaaggccatacttgtggccactgacattgatgctcttgactaatgggagtctaaagt 125  Q
    |||||||||||||||||||||| ||||||||||||| |||||| |||| ||| ||||||||||||||||||||||||||||||||||| |||||| || |    
32249123 ccacgacgggaacaccatataatccagccaattccactataaacaaggtcattcttgtggccactgacattgatgctcttgactaatgagagtctgaaat 32249024  T
126 cccactctagcatcttgtagggaaacgacgaagtaggtgcgtgaagatccatggtaacaggatacttagccatgtccacataaattttgcttattgattc 225  Q
    |||  | ||||||||||||||| |||||| || ||  ||| |||||||| || |||| || ||       | ||||||||||||||||| || |||||||    
32249023 ccctttgtagcatcttgtaggggaacgacaaaatacatgcatgaagatcaatagtaatagcat-------cttgtccacataaattttgtttgttgattc 32248931  T
226 t-----aagtctattgcattcctc--ctccatgggaatcatgttcaactttgcaaatattagagtgcatggacatcagaagaaaaagatga------cat 312  Q
    |     ||||||||||||||||||  ||| |||| |||||||||||||||||||||  ||||||||||||||||| ||||||||||  |||       ||    
32248930 tatgacaagtctattgcattcctcctctcgatggaaatcatgttcaactttgcaaaatttagagtgcatggacattagaagaaaaacttgatatcttaat 32248831  T
313 cctaattaagttgacacccaaaattcactacctatcatttgcaacaccctaacaaatttattg--acataaagaaatacaataaaaatcttggaagggat 410  Q
    ||||||||| || ||||||||||||||||| |||| ||||||||||  |||||||||||||||  | ||||  |||||||||||| ||||||| | |  |    
32248830 cctaattaa-ttaacacccaaaattcacta-ctataatttgcaacaaactaacaaatttattgatagataattaaatacaataaacatcttggga-gact 32248734  T
411 agaccaaaacccaagaagtaggataaccgctcatgaagaaaaagagtgcaattcaataac 470  Q
    ||||||||||||||||||||||||||   |||| |||| || ||||||||||||||||||    
32248733 agaccaaaacccaagaagtaggataaatcctcacgaaggaatagagtgcaattcaataac 32248674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 30 - 213
Target Start/End: Complemental strand, 32264396 - 32264213
Alignment:
30 gacgggaacaccatataacccagccaattccaatataaaaaaggccatacttgtggccactgacattgatgctcttgactaatgggagtctaaagtccca 129  Q
    ||||| |||||||||||| ||||| ||||||| |||||| |||| ||| |||||||||| |||||||||||||||||||||||||| ||| ||| ||||     
32264396 gacggaaacaccatataatccagctaattccagtataaacaaggacattcttgtggccattgacattgatgctcttgactaatgggcgtccaaaatccct 32264297  T
130 ctctagcatcttgtagggaaacgacgaagtaggtgcgtgaagatccatggtaacaggatacttagccatgtccacataaatttt 213  Q
     | |||||||||||||||||||||||||||| ||||||||||||| || |||| |||||||| |||| ||||||||||||||||    
32264296 ttgtagcatcttgtagggaaacgacgaagtacgtgcgtgaagatcaatagtaataggatactcagccttgtccacataaatttt 32264213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 420
Target Start/End: Complemental strand, 32236595 - 32236485
Alignment:
311 atcctaattaagttgacacccaaaattcactacctatcatttgcaacaccctaacaaatttattg--acataaagaaatacaataaaaatcttggaaggg 408  Q
    ||||||||||  || |||||||||||||||||| ||| ||||||||||  |||||||||||||||  | | ||||| |||||||||| |||||||  ||     
32236595 atcctaattagattaacacccaaaattcactac-tataatttgcaacaaactaacaaatttattgatagagaaagatatacaataaacatcttgggggga 32236497  T
409 atagaccaaaac 420  Q
     |||||||||||    
32236496 ctagaccaaaac 32236485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 73; Significance: 4e-33; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 226 - 391
Target Start/End: Complemental strand, 23203119 - 23202952
Alignment:
226 taagtctattgcattcctcctccatgggaatcatgttcaactttgcaaatattagagtgcatggacatcagaagaaaaagatgacatcctaattaagttg 325  Q
    ||||| |||||||||| |||||||||| | ||||||||||||||||||| |||||||||||||| ||| ||| ||  |   ||||||||||| || ||||    
23203119 taagtatattgcattcatcctccatggaagtcatgttcaactttgcaaaaattagagtgcatgggcattagatgatgagcttgacatcctaactaggttg 23203020  T
326 acacccaaaattcactacctatcatttgcaacaccctaacaaatttattg--acataaagaaatacaa 391  Q
    | | || ||||||| |||||||||||||||||| ||||||||||||||||  | ||||||||||||||    
23203019 agatcctaaattcattacctatcatttgcaacatcctaacaaatttattgataaataaagaaatacaa 23202952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 481 - 563
Target Start/End: Complemental strand, 23194092 - 23194011
Alignment:
481 accaaactcaaaataaaacaactaaccatcatctaaatctataactttctaaagaagttttctttgatacaccttgatattag 563  Q
    ||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| ||  |||||||||||||| |||||    
23194092 accaaactcaaaataaagcaactaaccatcatctaaatctgtaactttctaaagaagtctt-gttgatacaccttgacattag 23194011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98113 times since January 2019
Visitors: 2269