View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9096J-LTR4-TNT-insertion-5 (Length: 572)

Name: F9096J-LTR4-TNT-insertion-5
Description: F9096J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9096J-LTR4-TNT-insertion-5
[»] chr5 (4 HSPs)
chr5 (10-562)||(32254851-32255403)
chr5 (26-470)||(32248674-32249123)
chr5 (30-213)||(32264213-32264396)
chr5 (311-420)||(32236485-32236595)
[»] chr1 (2 HSPs)
chr1 (226-391)||(23202952-23203119)
chr1 (481-563)||(23194011-23194092)

Alignment Details
Target: chr5 (Bit Score: 549; Significance: 0; HSPs: 4)
Name: chr5

Target: chr5; HSP #1
Raw Score: 549; E-Value: 0
Query Start/End: Original strand, 10 - 562
Target Start/End: Complemental strand, 32255403 - 32254851
10 cgtagcaccgcaacatccacgacgggaacaccatataacccagccaattccaatataaaaaaggccatacttgtggccactgacattgatgctcttgact 109  Q
32255403 cgtagcaccgcaacatccacgacgggaacaccatataacccagccaattccaatataaaaaaggccatacttgtggccactgacattgatgctcttgact 32255304  T
110 aatgggagtctaaagtcccactctagcatcttgtagggaaacgacgaagtaggtgcgtgaagatccatggtaacaggatacttagccatgtccacataaa 209  Q
32255303 aatgggagtctaaagtcccactctagcatcttgtagggaaacgacgaagtaggtgcgtgaagatccatggtaacaggatacttagccatgtccacataaa 32255204  T
210 ttttgcttattgattctaagtctattgcattcctcctccatgggaatcatgttcaactttgcaaatattagagtgcatggacatcagaagaaaaagatga 309  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
32255203 ttttgcttattgattctaagtctattgcattcctcctccatgggaatcatgttcaactttgcaaatattagagtgcatggacatcagaagaaaaagttga 32255104  T
310 catcctaattaagttgacacccaaaattcactacctatcatttgcaacaccctaacaaatttattgacataaagaaatacaataaaaatcttggaaggga 409  Q
32255103 catcctaattaagttgacacccaaaattcactacctatcatttgcaacaccctaacaaatttattgacataaagaaatacaataaaaatcttggaaggga 32255004  T
410 tagaccaaaacccaagaagtaggataaccgctcatgaagaaaaagagtgcaattcaataactagcaacaagaccaaactcaaaataaaacaactaaccat 509  Q
32255003 tagaccaaaacccaagaagtaggataaccgctcatgaagaaaaagagtgcaattcaataactagcaacaagaccaaactcaaaataaaacaactaaccat 32254904  T
510 catctaaatctataactttctaaagaagttttctttgatacaccttgatatta 562  Q
32254903 catctaaatctataactttctaaagaagttttctttgatacaccttgatatta 32254851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 26 - 470
Target Start/End: Complemental strand, 32249123 - 32248674
26 ccacgacgggaacaccatataacccagccaattccaatataaaaaaggccatacttgtggccactgacattgatgctcttgactaatgggagtctaaagt 125  Q
    |||||||||||||||||||||| ||||||||||||| |||||| |||| ||| ||||||||||||||||||||||||||||||||||| |||||| || |    
32249123 ccacgacgggaacaccatataatccagccaattccactataaacaaggtcattcttgtggccactgacattgatgctcttgactaatgagagtctgaaat 32249024  T
126 cccactctagcatcttgtagggaaacgacgaagtaggtgcgtgaagatccatggtaacaggatacttagccatgtccacataaattttgcttattgattc 225  Q
    |||  | ||||||||||||||| |||||| || ||  ||| |||||||| || |||| || ||       | ||||||||||||||||| || |||||||    
32249023 ccctttgtagcatcttgtaggggaacgacaaaatacatgcatgaagatcaatagtaatagcat-------cttgtccacataaattttgtttgttgattc 32248931  T
226 t-----aagtctattgcattcctc--ctccatgggaatcatgttcaactttgcaaatattagagtgcatggacatcagaagaaaaagatga------cat 312  Q
    |     ||||||||||||||||||  ||| |||| |||||||||||||||||||||  ||||||||||||||||| ||||||||||  |||       ||    
32248930 tatgacaagtctattgcattcctcctctcgatggaaatcatgttcaactttgcaaaatttagagtgcatggacattagaagaaaaacttgatatcttaat 32248831  T
313 cctaattaagttgacacccaaaattcactacctatcatttgcaacaccctaacaaatttattg--acataaagaaatacaataaaaatcttggaagggat 410  Q
    ||||||||| || ||||||||||||||||| |||| ||||||||||  |||||||||||||||  | ||||  |||||||||||| ||||||| | |  |    
32248830 cctaattaa-ttaacacccaaaattcacta-ctataatttgcaacaaactaacaaatttattgatagataattaaatacaataaacatcttggga-gact 32248734  T
411 agaccaaaacccaagaagtaggataaccgctcatgaagaaaaagagtgcaattcaataac 470  Q
    ||||||||||||||||||||||||||   |||| |||| || ||||||||||||||||||    
32248733 agaccaaaacccaagaagtaggataaatcctcacgaaggaatagagtgcaattcaataac 32248674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 30 - 213
Target Start/End: Complemental strand, 32264396 - 32264213
30 gacgggaacaccatataacccagccaattccaatataaaaaaggccatacttgtggccactgacattgatgctcttgactaatgggagtctaaagtccca 129  Q
    ||||| |||||||||||| ||||| ||||||| |||||| |||| ||| |||||||||| |||||||||||||||||||||||||| ||| ||| ||||     
32264396 gacggaaacaccatataatccagctaattccagtataaacaaggacattcttgtggccattgacattgatgctcttgactaatgggcgtccaaaatccct 32264297  T
130 ctctagcatcttgtagggaaacgacgaagtaggtgcgtgaagatccatggtaacaggatacttagccatgtccacataaatttt 213  Q
     | |||||||||||||||||||||||||||| ||||||||||||| || |||| |||||||| |||| ||||||||||||||||    
32264296 ttgtagcatcttgtagggaaacgacgaagtacgtgcgtgaagatcaatagtaataggatactcagccttgtccacataaatttt 32264213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 420
Target Start/End: Complemental strand, 32236595 - 32236485
311 atcctaattaagttgacacccaaaattcactacctatcatttgcaacaccctaacaaatttattg--acataaagaaatacaataaaaatcttggaaggg 408  Q
    ||||||||||  || |||||||||||||||||| ||| ||||||||||  |||||||||||||||  | | ||||| |||||||||| |||||||  ||     
32236595 atcctaattagattaacacccaaaattcactac-tataatttgcaacaaactaacaaatttattgatagagaaagatatacaataaacatcttgggggga 32236497  T
409 atagaccaaaac 420  Q
32236496 ctagaccaaaac 32236485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 73; Significance: 4e-33; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 226 - 391
Target Start/End: Complemental strand, 23203119 - 23202952
226 taagtctattgcattcctcctccatgggaatcatgttcaactttgcaaatattagagtgcatggacatcagaagaaaaagatgacatcctaattaagttg 325  Q
    ||||| |||||||||| |||||||||| | ||||||||||||||||||| |||||||||||||| ||| ||| ||  |   ||||||||||| || ||||    
23203119 taagtatattgcattcatcctccatggaagtcatgttcaactttgcaaaaattagagtgcatgggcattagatgatgagcttgacatcctaactaggttg 23203020  T
326 acacccaaaattcactacctatcatttgcaacaccctaacaaatttattg--acataaagaaatacaa 391  Q
    | | || ||||||| |||||||||||||||||| ||||||||||||||||  | ||||||||||||||    
23203019 agatcctaaattcattacctatcatttgcaacatcctaacaaatttattgataaataaagaaatacaa 23202952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 481 - 563
Target Start/End: Complemental strand, 23194092 - 23194011
481 accaaactcaaaataaaacaactaaccatcatctaaatctataactttctaaagaagttttctttgatacaccttgatattag 563  Q
    ||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| ||  |||||||||||||| |||||    
23194092 accaaactcaaaataaagcaactaaccatcatctaaatctgtaactttctaaagaagtctt-gttgatacaccttgacattag 23194011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC