View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9096J-LTR4-TNT-insertion-6 (Length: 420)

Name: F9096J-LTR4-TNT-insertion-6
Description: F9096J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9096J-LTR4-TNT-insertion-6
F9096J-LTR4-TNT-insertion-6
[»] chr6 (19 HSPs)
chr6 (10-411)||(31562646-31563047)
chr6 (12-389)||(33262413-33262787)
chr6 (12-411)||(33387941-33388343)
chr6 (12-411)||(33644365-33644761)
chr6 (12-389)||(28870016-28870390)
chr6 (12-411)||(33304271-33304667)
chr6 (128-389)||(33398957-33399215)
chr6 (246-411)||(33358885-33359050)
chr6 (231-411)||(33285621-33285801)
chr6 (244-411)||(33271841-33272008)
chr6 (256-411)||(33410033-33410188)
chr6 (122-411)||(33057463-33057752)
chr6 (140-411)||(9166667-9166935)
chr6 (12-221)||(33271582-33271782)
chr6 (12-180)||(33285381-33285552)
chr6 (12-74)||(33057365-33057427)
chr6 (12-82)||(33398859-33398929)
chr6 (15-74)||(33409768-33409827)
chr6 (122-179)||(33409869-33409926)
[»] scaffold1408 (1 HSPs)
scaffold1408 (12-389)||(431-808)
[»] scaffold0428 (1 HSPs)
scaffold0428 (12-389)||(6177-6554)
[»] chr2 (2 HSPs)
chr2 (246-389)||(17440727-17440870)
chr2 (20-87)||(17441014-17441081)
[»] chr4 (12 HSPs)
chr4 (261-389)||(31157250-31157378)
chr4 (261-382)||(31504032-31504153)
chr4 (261-383)||(31478846-31478968)
chr4 (268-382)||(31498902-31499016)
chr4 (268-389)||(31148343-31148464)
chr4 (265-384)||(31472390-31472509)
chr4 (19-158)||(31472625-31472764)
chr4 (353-389)||(31526532-31526568)
chr4 (12-87)||(31499201-31499276)
chr4 (20-82)||(31157018-31157080)
chr4 (177-218)||(31157172-31157213)
chr4 (109-157)||(31504269-31504317)
[»] chr7 (1 HSPs)
chr7 (269-387)||(6785236-6785354)


Alignment Details
Target: chr6 (Bit Score: 398; Significance: 0; HSPs: 19)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 10 - 411
Target Start/End: Complemental strand, 31563047 - 31562646
Alignment:
10 actctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggta 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31563047 actctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggta 31562948  T
110 ggagtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatg 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31562947 ggagtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatg 31562848  T
210 accaatcctgtagtccaccatttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctcca 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31562847 accaatcctgtagtccaccatttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctcca 31562748  T
310 aatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaat 409  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
31562747 aatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctagcgagcttaaacattcaat 31562648  T
410 tg 411  Q
    ||    
31562647 tg 31562646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 389
Target Start/End: Original strand, 33262413 - 33262787
Alignment:
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||| ||||||||||||||||||||| ||||||||||||||| | ||||||||| ||||||||  |||||| ||||||||||||||||| | ||||||||    
33262413 tctactggtattgaatcacccatgctctgattgttgatccaacttggtatttcatttcctggactaacaatttgaaactcatccaaataagtagggtagg 33262512  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | ||| | ||||| | ||||||||||| | ||||||||||||||||||| |||||| | ||||||||||      ||||||| |||||||| ||||||||    
33262513 attgttggtatgcttgaatgaattgtgtcgtccatgaaaatgtcatgctactgcaacgttccctctcac------ccaattttggacagttgaaaatgac 33262606  T
212 caatcctgtagtccacc---atttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctcc 308  Q
    |||||||||| || ||    | |  ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||  ||||||||||    
33262607 caatcctgtattcaacttatactccttctcacgatgatcccgcccaatagaggtaggagaaggaagttgaggcaaagattccaacaacctgcaatgctcc 33262706  T
309 aaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    ||||||||||||||||||||||||||||||| || ||||||||||||||||||||  ||||||||||||||||||||||||    
33262707 aaatttaaatatacaagtttggaaagcttcctcaggctaggtagtgtcacaaaatcatttccccctaaatttaatctttct 33262787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 12 - 411
Target Start/End: Original strand, 33387941 - 33388343
Alignment:
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |  |||||| |||| |  ||| ||||||||||||||||    
33387941 tctattagtattgaatcacccatgctctgattgttgatccaactcggtatttcacttcctgtagtaacaatttgaatcgtatcaaaataggcagggtagg 33388040  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
      ||| | | ||||||||| ||||||| ||||||||||||||||||||| ||||||  |||||| ||||      ||| ||| |||||||| |||| ||     
33388041 tttgtcggtttgccttaataaattgtgtcatccatgaaaatgtcatgctactgcaacactccctatcac------ccagttttggacagttgaaaacgat 33388134  T
212 caatcctgtagtccacc-------at--ttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaa 302  Q
    |||||||||  ||||||       ||  |||||||||||| |||||||||||||||||||| |||||||||||||||| ||||||| ||| |||| ||||    
33388135 caatcctgtgatccacccaaacttatgcttgttctcacgatgatcccgcccaatagtggtaagagaaggaagttgaggaaaagatttcaagaacttgcaa 33388234  T
303 tgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaac 402  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| | |||  |||||    
33388235 tgctccaaatttaaatatacaagtttggaaagcttcctcaagctaggtagtgtcacaaaatcgtttccccctaaatttaatttttctagtgagtgtaaac 33388334  T
403 attcaattg 411  Q
    |||||||||    
33388335 attcaattg 33388343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 12 - 411
Target Start/End: Complemental strand, 33644761 - 33644365
Alignment:
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||||| ||||||||| |||||  || ||||||||||||||| | ||||||||||||||||||   ||||| |||  |  ||| || ||||  |||||||    
33644761 tctatttgtattgaataacccacactttgattgttgatccaacttggtatttcacttcctggagttacaatttgagtcctatcaaagtaggttgggtagg 33644662  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | ||| | | ||||| ||||||||||  |||||||||||||||||||||||||||| | ||||||||||      ||||||| | |||||| ||||||||    
33644661 attgtaggtttgcctgaatgaattgtatcatccatgaaaatgtcatgctcctgcaacgttccctctcac------ccaattttgaacagttgaaaatgac 33644568  T
212 caatcctgtagtccac-cat--ttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctcc 308  Q
    |||||||| | ||||  |||  |  ||||||   || |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| || |||    
33644567 caatcctgaaatccagacatcgtcattctcatctcgttcccgcccaatagtggtaggggaaggaagttgaggcaaagattccaacaacttgcagtgttcc 33644468  T
309 aaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaa 408  Q
    ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||   |||||||||||    
33644467 aaatttaaatatacaagtttggaaagcttcctcaggctaggtagtgtcacaaaatagtttccccctaaatttaatctttctagcgaatgtaaacattcaa 33644368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 12 - 389
Target Start/End: Complemental strand, 28870390 - 28870016
Alignment:
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||||| |||||||| |||||||||| |||||||| |||||| | ||||||||||||||||||  |||||||| |||| ||||||||||| || ||||||    
28870390 tctatttgtattgaaccacccatgctctgattgttaatccaacttggtatttcacttcctggagtaacaatattaaacgcatccaaatagacaaggtagg 28870291  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | ||| | ||||||  ||||||||||  |||||||||||||| |||||| |  ||| | ||||||||||      | || || |||||||| |||||||     
28870290 attgtcggtatgcccgaatgaattgtttcatccatgaaaatgccatgctacaacaacgttccctctcac------ctaaatttggacagttgaaaatgat 28870197  T
212 caatcctgtagtccacc---atttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctcc 308  Q
    ||| |||||  ||||     ||||| |||||| |  ||||||||| |||| |||||||||||||||||||||||||||||| ||||||| ||||||||||    
28870196 caaacctgttctccagggatatttgctctcacaattatcccgcccgataggggtaggagaaggaagttgaggcaaagattcaaacaacttgcaatgctcc 28870097  T
309 aaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    |||||||||||| |||||||||||||||||| || |||||| |||||||||||||||||||||| ||| ||||||||||||    
28870096 aaatttaaatattcaagtttggaaagcttcctcaggctaggcagtgtcacaaaatagtttccccgtaagtttaatctttct 28870016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 12 - 411
Target Start/End: Original strand, 33304271 - 33304667
Alignment:
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||||| ||||||||||||||| ||| | ||||||||||||| | ||||||||| ||||||||  |||||| |||| |  ||| ||  | | ||||||||    
33304271 tctatttgtattgaatcacccacgctcttattgttgatccaaattggtatttcatttcctggagtaacaatttgaatccaatcaaaggacgtagggtagg 33304370  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | ||||  | ||||| ||||||||||| || |||||||||||||||||| |||||| | ||||||||||      ||||||| |||||||| |||||||     
33304371 attgtgagtttgcctcaatgaattgtgtcaaccatgaaaatgtcatgctactgcaacgttccctctcac------ccaattttggacagttgaaaatgaa 33304464  T
212 caatcctgtagtcca---ccat---------ttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcg 299  Q
    ||||||||||| |||   |||          ||||||||||||  ||       |||| ||||||||||||||||||||||||||||||||||||||  |    
33304465 caatcctgtaggccagatccagaaatatttgttgttctcacga--at-------aatattggtaggagaaggaagttgaggcaaagattccaacaacatg 33304555  T
300 caatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagctta 399  Q
    ||||||| |||||||||||||||||||||||||||||||| || ||||||||| |||||||||| ||||||| |||| |||||||||||| |||||  ||    
33304556 caatgctgcaaatttaaatatacaagtttggaaagcttcctcaggctaggtagagtcacaaaattgtttccctctaagtttaatctttctagcgagtata 33304655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 128 - 389
Target Start/End: Original strand, 33398957 - 33399215
Alignment:
128 aatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgaccaatcctgtagtccac 227  Q
    ||||||||||  ||||||||||||||||||||| |||||| | ||||||||||      ||||||| | |||||| |||||||||||||||| | ||||     
33398957 aatgaattgtatcatccatgaaaatgtcatgctactgcaacgttccctctcac------ccaattttgaacagttgaaaatgaccaatcctgaaatccag 33399050  T
228 -cat--ttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaa 324  Q
     |||  |  ||||||   || |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| || |||||||||||||||||||    
33399051 tcatcgtcattctcatctcgttcccgcccaatagtggtaggggaaggaagttgaggcaaagattccaacaacttgcagtgttccaaatttaaatatacaa 33399150  T
325 gtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    ||| ||||||||||| || |||||||||||||||||||| |||||||  ||||||||||||||||    
33399151 gttcggaaagcttcctcaggctaggtagtgtcacaaaattgtttccctttaaatttaatctttct 33399215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 246 - 411
Target Start/End: Original strand, 33358885 - 33359050
Alignment:
246 tcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagc 345  Q
    |||| |||||||||||||||| |||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||| || ||    
33358885 tcccacccaatagtggtaggaaaaggaagttgaggcaaagattccaacaacttgcaatgttccaaatttaaatatacaagtttagaaagcttcctcaggc 33358984  T
346 taggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaattg 411  Q
    |||||||||||||||||| ||||||||||||||||||| ||||| || |   ||||||||||||||    
33358985 taggtagtgtcacaaaatcgtttccccctaaatttaatatttctagccaatgtaaacattcaattg 33359050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 231 - 411
Target Start/End: Original strand, 33285621 - 33285801
Alignment:
231 ttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttgg 330  Q
    |||||||||||| |||||  ||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
33285621 ttgttctcacgatgatcctccccaatattggtaggaaaaggaagttgaggcaaagattccaacaacttgcaatgctccaaatttaaatatacaagtttgg 33285720  T
331 aaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaattg 411  Q
    | ||||| | || |||||||||||||||||||| |||||||||||| |||||| ||||| || |   ||||||||||||||    
33285721 acagctttctcaggctaggtagtgtcacaaaattgtttccccctaagtttaatatttctagccaatataaacattcaattg 33285801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 244 - 411
Target Start/End: Original strand, 33271841 - 33272008
Alignment:
244 gatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaa 343  Q
    ||||||||||| |||| |  |||||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| ||     
33271841 gatcccgcccactagtaggtggagaaggaagtcgaggcaaagattccaacaacttgcaatgttccaaatttaaatatacaagtttggaaagcttcctcag 33271940  T
344 gctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaattg 411  Q
    |||||||||||||||||||| |||||||||||||| |||||||||| || |   ||||||||||||||    
33271941 gctaggtagtgtcacaaaattgtttccccctaaatctaatctttctagccaatgtaaacattcaattg 33272008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 256 - 411
Target Start/End: Original strand, 33410033 - 33410188
Alignment:
256 tagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgt 355  Q
    ||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||| ||||||| |||||||||||||||||| |||||||||||||||    
33410033 tagtggtaggaaaaggaagttgaggcaaagattccaacaacttgcaatgctgcaaatctaaatattcaagtttggaaagcttcctcaagctaggtagtgt 33410132  T
356 cacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaattg 411  Q
    |||||||||||||||| |||||| |||||||||| ||||   ||||| ||||||||    
33410133 cacaaaatagtttcccgctaaatataatctttctagcgaatgtaaaccttcaattg 33410188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 122 - 411
Target Start/End: Original strand, 33057463 - 33057752
Alignment:
122 tgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgaccaatcctgta 221  Q
    ||||||||||||||||  ||||||| ||| |||||||||||||||||| ||||||||||      ||||||| |||||||| ||||||| |||||||| |    
33057463 tgccttaatgaattgtttcatccataaaagtgtcatgctcctgcaatgttccctctcac------ccaattttggacagttgaaaatgagcaatcctgca 33057556  T
222 gtccaccat--------ttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatt 313  Q
      |||| |         | || ||||||| || ||  |||| || |||||||| |||||||||||||||||||||||||||| | |||||||||||||||    
33057557 --ccacaaaaatagtcgtcgtactcacgatgaacctccccagtattggtaggaaaaggaagttgaggcaaagattccaacaatttgcaatgctccaaatt 33057654  T
314 taaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaattg 411  Q
    |||||||||||||||||| ||||||| || |||||||| ||||||||||| ||||||| ||||||||||||||||| || |   ||||||||||||||    
33057655 taaatatacaagtttggatagcttcctcaggctaggtaatgtcacaaaatcgtttcccgctaaatttaatctttctagccaatgtaaacattcaattg 33057752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 140 - 411
Target Start/End: Original strand, 9166667 - 9166935
Alignment:
140 catccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgaccaatcctgtagtccacca---tttgttc 236  Q
    ||||||||||||||||||||| |||||||| ||| | ||||||      ||||  |||||||| ||||||||||||||||| ||| |  |   |||||||    
9166667 catccatgaaaatgtcatgctactgcaatgttccttatcactc------aattctggacagttgaaaatgaccaatcctgttgtcgagaaaaatttgttc 9166760  T
237 tcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagct 336  Q
    |||  | || ||| | | |||||| ||| | ||||||||||||||||| | |||||||||  ||||||||||||||||||||||||||||||||||||||    
9166761 tcattatgagcccactcgatagtgttagaaaaaggaagttgaggcaaaaactccaacaacctgcaatgctccaaatttaaatatacaagtttggaaagct 9166860  T
337 tccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaattg 411  Q
    ||| |||||||||||||||| |||||| | |||||||||| |||||||||||| || | | ||||||||||||||    
9166861 tcctcaagctaggtagtgtcgcaaaatcgattccccctaagtttaatctttctagccaccgtaaacattcaattg 9166935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 33271582 - 33271782
Alignment:
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    ||||||||||| |||||||||||||| ||||||||||||||| | ||||||||||||||||||   | |||||||||||||| |||||| |             
33271582 tctattggtatcgaatcacccatgctctgattgttgatccaacttggtatttcacttcctggagttataatatgaaactcattcaaataag--------- 33271672  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | || || | |||| |||||||||||  ||||||||||||||||| ||| |||||| | ||||||||||  ||||||||||| |||||||| ||||||||    
33271673 attgcgggtttgccataatgaattgtatcatccatgaaaatgtcaagctactgcaacgttccctctcacagtcagccaattttggacagttgaaaatgac 33271772  T
212 caatcctgta 221  Q
    ||||||||||    
33271773 caatcctgta 33271782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 12 - 180
Target Start/End: Original strand, 33285381 - 33285552
Alignment:
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaatag---gcagggt 108  Q
    |||||||||||||||  ||||| ||| ||||| || |||||| | ||||||||||||||||||  ||||||||||| | | || ||  ||   |||||||    
33285381 tctattggtattgaactacccacgctctgattattaatccaacttggtatttcacttcctggagtaacaatatgaatcccttcaaataaggacgcagggt 33285480  T
109 aggagtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcac 180  Q
    |  ||||| | |||||||  |||||||||  |||||||||||||| |||||| |||||| | ||||| ||||    
33285481 aaaagtgttggtatgcctggatgaattgtatcatccatgaaaatgccatgctactgcaacgttccctttcac 33285552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 12 - 74
Target Start/End: Original strand, 33057365 - 33057427
Alignment:
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctgga 74  Q
    ||||||| |||||||| |||||| || ||||||||||||||| | ||||||||||||||||||    
33057365 tctattgctattgaataacccatcctctgattgttgatccaacttggtatttcacttcctgga 33057427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 12 - 82
Target Start/End: Original strand, 33398859 - 33398929
Alignment:
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaat 82  Q
    |||||| |||||||||||||||  |  ||||||||||||||| | ||||||||||||||||||| ||||||    
33398859 tctatttgtattgaatcacccacacactgattgttgatccaacttggtatttcacttcctggaataacaat 33398929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 15 - 74
Target Start/End: Original strand, 33409768 - 33409827
Alignment:
15 attggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctgga 74  Q
    |||| ||||||| |||||| ||| ||||||||||||||| | ||||||||||||||||||    
33409768 attgatattgaagcacccacgctctgattgttgatccaacttggtatttcacttcctgga 33409827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 33409869 - 33409926
Alignment:
122 tgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctca 179  Q
    ||||| |||||| |||||||||||||||| ||| ||||| |||||| | |||||||||    
33409869 tgcctgaatgaaatgtgccatccatgaaattgtgatgctactgcaacgttccctctca 33409926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1408 (Bit Score: 146; Significance: 9e-77; HSPs: 1)
Name: scaffold1408
Description:

Target: scaffold1408; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 12 - 389
Target Start/End: Original strand, 431 - 808
Alignment:
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||||| |||||||| |||||||||| ||||||||||||||  | ||||||||||||||||||  |||||| |||| ||||| |||||| | |  |||||    
431 tctattagtattgaaccacccatgctctgattgttgatccagcttggtatttcacttcctggagtaacaatttgaagctcatacaaatacggaccgtagg 530  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | ||| | | ||||| ||||||||||  ||||||||||||||| ||||| || |||   ||||||||||      ||||||| |||||||| ||||||||    
531 attgttggtttgcctgaatgaattgtttcatccatgaaaatgttatgctactacaacattccctctcac------ccaattttggacagttgaaaatgac 624  T
212 caatcctgtagtccaccatt------tgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgc 305  Q
    ||||||| |||||||  | |      |||||||| ||  |||| ||||||||||| | ||| |||||||||||||||| ||||||||||||| |||||||    
625 caatcctttagtccaataatattcgttgttctcatgataatccggcccaatagtgcttggaaaaggaagttgaggcaacgattccaacaacttgcaatgc 724  T
306 tccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    ||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||  ||||||||||||||||||||||||    
725 tccaaatttaaatatacaagtctggaaagcttcctcatgctaggtagtgtcacaaaattatttccccctaaatttaatctttct 808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0428 (Bit Score: 146; Significance: 9e-77; HSPs: 1)
Name: scaffold0428
Description:

Target: scaffold0428; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 12 - 389
Target Start/End: Original strand, 6177 - 6554
Alignment:
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||||| |||||||| |||||||||| ||||||||||||||  | ||||||||||||||||||  |||||| |||| ||||| |||||| | |  |||||    
6177 tctattagtattgaaccacccatgctctgattgttgatccagcttggtatttcacttcctggagtaacaatttgaagctcatacaaatacggaccgtagg 6276  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | ||| | | ||||| ||||||||||  ||||||||||||||| ||||| || |||   ||||||||||      ||||||| |||||||| ||||||||    
6277 attgttggtttgcctgaatgaattgtttcatccatgaaaatgttatgctactacaacattccctctcac------ccaattttggacagttgaaaatgac 6370  T
212 caatcctgtagtccaccatt------tgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgc 305  Q
    ||||||| |||||||  | |      |||||||| ||  |||| ||||||||||| | ||| |||||||||||||||| ||||||||||||| |||||||    
6371 caatcctttagtccaataatattcgttgttctcatgataatccggcccaatagtgcttggaaaaggaagttgaggcaacgattccaacaacttgcaatgc 6470  T
306 tccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    ||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||  ||||||||||||||||||||||||    
6471 tccaaatttaaatatacaagtctggaaagcttcctcatgctaggtagtgtcacaaaattatttccccctaaatttaatctttct 6554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 246 - 389
Target Start/End: Complemental strand, 17440870 - 17440727
Alignment:
246 tcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagc 345  Q
    |||||||| |||| ||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||||||| || ||    
17440870 tcccgcccgatagcggtaggaaaaggaagttgaggcaaagattccaacaacttgcaatgctgcaaatttaaatatacaagtttcgaaagcttcctcaggc 17440771  T
346 taggtagtgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    ||||||||||| ||||||  ||||||||||||||||||||||||    
17440770 taggtagtgtcgcaaaatcatttccccctaaatttaatctttct 17440727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 17441081 - 17441014
Alignment:
20 tattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaa 87  Q
    |||||||||||||| ||| | ||||||||||||| | |||||||| |||||||||  |||||||||||    
17441081 tattgaatcacccacgctcttattgttgatccaacttggtatttcgcttcctggactaacaatatgaa 17441014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 81; Significance: 5e-38; HSPs: 12)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 261 - 389
Target Start/End: Original strand, 31157250 - 31157378
Alignment:
261 gtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaa 360  Q
    |||||| ||||||||||||||||||||||||| | || |||||||||||| ||||||||||||||||||||||||| || || |||||| ||||||||||    
31157250 gtaggaaaaggaagttgaggcaaagattccaaaagcttgcaatgctccaagtttaaatatacaagtttggaaagctccctcaggctaggcagtgtcacaa 31157349  T
361 aatagtttccccctaaatttaatctttct 389  Q
    ||| ||| ||||||| |||||||||||||    
31157350 aattgttcccccctatatttaatctttct 31157378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 261 - 382
Target Start/End: Complemental strand, 31504153 - 31504032
Alignment:
261 gtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaa 360  Q
    ||||||||||||||   |||||||||||||||||  | |||||||||||| ||||||||||||||||||||||||| || || |||||||| ||||||||    
31504153 gtaggagaaggaagaacaggcaaagattccaacagtttgcaatgctccaagtttaaatatacaagtttggaaagctccctcaggctaggtactgtcacaa 31504054  T
361 aatagtttccccctaaatttaa 382  Q
    |||  ||||||||||| |||||    
31504053 aattatttccccctaagtttaa 31504032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 261 - 383
Target Start/End: Complemental strand, 31478968 - 31478846
Alignment:
261 gtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaa 360  Q
    |||||||||||||||  ||||||||||| ||||| || ||||||||| ||  |||||||||||||||| ||||||| || ||  ||||||| ||||||||    
31478968 gtaggagaaggaagtacaggcaaagatttcaacagcttgcaatgctctaagcttaaatatacaagttttgaaagctccctcagactaggtactgtcacaa 31478869  T
361 aatagtttccccctaaatttaat 383  Q
    ||| |||||||||||||||||||    
31478868 aattgtttccccctaaatttaat 31478846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 268 - 382
Target Start/End: Complemental strand, 31499016 - 31498902
Alignment:
268 aaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtt 367  Q
    |||||||||||||||||||||||||||| | |||||| || || |||||| |||||||||||||||| | || || |||||||| ||||||||| | |||    
31499016 aaggaagttgaggcaaagattccaacaatttgcaatgttctaagtttaaacatacaagtttggaaaggtccctcaggctaggtaatgtcacaaacttgtt 31498917  T
368 tccccctaaatttaa 382  Q
    |||||||||||||||    
31498916 tccccctaaatttaa 31498902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 268 - 389
Target Start/End: Original strand, 31148343 - 31148464
Alignment:
268 aaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtt 367  Q
    |||||||||||||||| |||| ||||||||  ||||||| ||| ||||||||| ||||| |||| |||||||  | ||||||||  |||||||||| |||    
31148343 aaggaagttgaggcaacgatttcaacaacttacaatgctgcaagtttaaatatgcaagtctggatagcttcctaaggctaggtaccgtcacaaaattgtt 31148442  T
368 tccccctaaatttaatctttct 389  Q
    |||||||| |||||||||||||    
31148443 tccccctagatttaatctttct 31148464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 265 - 384
Target Start/End: Complemental strand, 31472509 - 31472390
Alignment:
265 gagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaata 364  Q
    |||||||||||| ||||||||||| ||||  |  || ||| || || ||||||||||||||||||||||||| || |  |||||||| |||||||||||     
31472509 gagaaggaagtttaggcaaagatttcaactgcgggcgatgttctaagtttaaatatacaagtttggaaagctccctcgggctaggtactgtcacaaaatt 31472410  T
365 gtttccccctaaatttaatc 384  Q
     || || |||| ||||||||    
31472409 attccctcctacatttaatc 31472390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 19 - 158
Target Start/End: Complemental strand, 31472764 - 31472625
Alignment:
19 gtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtaggagtgtgg 118  Q
    |||| ||||||||| || | |||||||||| |||| | ||||||||||||||||||  |||||| ||||    |||  || || ||||| |||| |||||    
31472764 gtatcgaatcacccttgttctgattgttgaaccaacttggtatttcacttcctggagtaacaatctgaattatatcataacagtcagggaaggattgtgg 31472665  T
119 atatgccttaatgaattgtgccatccatgaaaatgtcatg 158  Q
    || ||||| ||||| ||||  |||||||||||||||||||    
31472664 atttgcctgaatgagttgtatcatccatgaaaatgtcatg 31472625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 389
Target Start/End: Original strand, 31526532 - 31526568
Alignment:
353 tgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    ||||||||||| |||||||||||||||||||||||||    
31526532 tgtcacaaaattgtttccccctaaatttaatctttct 31526568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 12 - 87
Target Start/End: Complemental strand, 31499276 - 31499201
Alignment:
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaa 87  Q
    |||||| |||||||||||||| |||| ||||| || | |||| | | ||||||||||||||||  |||||||||||    
31499276 tctattcgtattgaatcacccttgctctgattcttaaaccaacttgatatttcacttcctggagtaacaatatgaa 31499201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 31157018 - 31157080
Alignment:
20 tattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaat 82  Q
    |||||||||||||  ||| |||||||||| |||| | |||||||||||||| |||| ||||||    
31157018 tattgaatcaccctcgctctgattgttgaaccaaattggtatttcacttccaggaataacaat 31157080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 218
Target Start/End: Original strand, 31157172 - 31157213
Alignment:
177 tcactctcagccaatttcggacagttaaaaatgaccaatcct 218  Q
    ||||||||| ||||||| |||||||| |||||||||||||||    
31157172 tcactctcacccaatttaggacagttgaaaatgaccaatcct 31157213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 109 - 157
Target Start/End: Complemental strand, 31504317 - 31504269
Alignment:
109 aggagtgtggatatgccttaatgaattgtgccatccatgaaaatgtcat 157  Q
    |||| ||||| | ||||||||||||||||  ||||||||||||||||||    
31504317 aggattgtgggtttgccttaatgaattgtatcatccatgaaaatgtcat 31504269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 269 - 387
Target Start/End: Complemental strand, 6785354 - 6785236
Alignment:
269 aggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagttt 368  Q
    |||||| | ||||||| ||| |||||||| ||| || ||||| ||||||||||| ||||||||||||| |  || |||||| | ||||||||||| ||||    
6785354 aggaagatcaggcaaatatttcaacaacttgcagtgatccaagtttaaatatacgagtttggaaagctccttcaggctaggcaatgtcacaaaatggttt 6785255  T
369 ccccctaaatttaatcttt 387  Q
    |||||||||||||||||||    
6785254 ccccctaaatttaatcttt 6785236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98602 times since January 2019
Visitors: 2275