View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9096J-LTR4-TNT-insertion-6 (Length: 420)

Name: F9096J-LTR4-TNT-insertion-6
Description: F9096J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9096J-LTR4-TNT-insertion-6
[»] chr6 (19 HSPs)
chr6 (10-411)||(31562646-31563047)
chr6 (12-389)||(33262413-33262787)
chr6 (12-411)||(33387941-33388343)
chr6 (12-411)||(33644365-33644761)
chr6 (12-389)||(28870016-28870390)
chr6 (12-411)||(33304271-33304667)
chr6 (128-389)||(33398957-33399215)
chr6 (246-411)||(33358885-33359050)
chr6 (231-411)||(33285621-33285801)
chr6 (244-411)||(33271841-33272008)
chr6 (256-411)||(33410033-33410188)
chr6 (122-411)||(33057463-33057752)
chr6 (140-411)||(9166667-9166935)
chr6 (12-221)||(33271582-33271782)
chr6 (12-180)||(33285381-33285552)
chr6 (12-74)||(33057365-33057427)
chr6 (12-82)||(33398859-33398929)
chr6 (15-74)||(33409768-33409827)
chr6 (122-179)||(33409869-33409926)
[»] scaffold1408 (1 HSPs)
scaffold1408 (12-389)||(431-808)
[»] scaffold0428 (1 HSPs)
scaffold0428 (12-389)||(6177-6554)
[»] chr2 (2 HSPs)
chr2 (246-389)||(17440727-17440870)
chr2 (20-87)||(17441014-17441081)
[»] chr4 (12 HSPs)
chr4 (261-389)||(31157250-31157378)
chr4 (261-382)||(31504032-31504153)
chr4 (261-383)||(31478846-31478968)
chr4 (268-382)||(31498902-31499016)
chr4 (268-389)||(31148343-31148464)
chr4 (265-384)||(31472390-31472509)
chr4 (19-158)||(31472625-31472764)
chr4 (353-389)||(31526532-31526568)
chr4 (12-87)||(31499201-31499276)
chr4 (20-82)||(31157018-31157080)
chr4 (177-218)||(31157172-31157213)
chr4 (109-157)||(31504269-31504317)
[»] chr7 (1 HSPs)
chr7 (269-387)||(6785236-6785354)

Alignment Details
Target: chr6 (Bit Score: 398; Significance: 0; HSPs: 19)
Name: chr6

Target: chr6; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 10 - 411
Target Start/End: Complemental strand, 31563047 - 31562646
10 actctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggta 109  Q
31563047 actctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggta 31562948  T
110 ggagtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatg 209  Q
31562947 ggagtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatg 31562848  T
210 accaatcctgtagtccaccatttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctcca 309  Q
31562847 accaatcctgtagtccaccatttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctcca 31562748  T
310 aatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaat 409  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
31562747 aatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctagcgagcttaaacattcaat 31562648  T
410 tg 411  Q
31562647 tg 31562646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 389
Target Start/End: Original strand, 33262413 - 33262787
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||| ||||||||||||||||||||| ||||||||||||||| | ||||||||| ||||||||  |||||| ||||||||||||||||| | ||||||||    
33262413 tctactggtattgaatcacccatgctctgattgttgatccaacttggtatttcatttcctggactaacaatttgaaactcatccaaataagtagggtagg 33262512  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | ||| | ||||| | ||||||||||| | ||||||||||||||||||| |||||| | ||||||||||      ||||||| |||||||| ||||||||    
33262513 attgttggtatgcttgaatgaattgtgtcgtccatgaaaatgtcatgctactgcaacgttccctctcac------ccaattttggacagttgaaaatgac 33262606  T
212 caatcctgtagtccacc---atttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctcc 308  Q
    |||||||||| || ||    | |  ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||  ||||||||||    
33262607 caatcctgtattcaacttatactccttctcacgatgatcccgcccaatagaggtaggagaaggaagttgaggcaaagattccaacaacctgcaatgctcc 33262706  T
309 aaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    ||||||||||||||||||||||||||||||| || ||||||||||||||||||||  ||||||||||||||||||||||||    
33262707 aaatttaaatatacaagtttggaaagcttcctcaggctaggtagtgtcacaaaatcatttccccctaaatttaatctttct 33262787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 12 - 411
Target Start/End: Original strand, 33387941 - 33388343
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |  |||||| |||| |  ||| ||||||||||||||||    
33387941 tctattagtattgaatcacccatgctctgattgttgatccaactcggtatttcacttcctgtagtaacaatttgaatcgtatcaaaataggcagggtagg 33388040  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
      ||| | | ||||||||| ||||||| ||||||||||||||||||||| ||||||  |||||| ||||      ||| ||| |||||||| |||| ||     
33388041 tttgtcggtttgccttaataaattgtgtcatccatgaaaatgtcatgctactgcaacactccctatcac------ccagttttggacagttgaaaacgat 33388134  T
212 caatcctgtagtccacc-------at--ttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaa 302  Q
    |||||||||  ||||||       ||  |||||||||||| |||||||||||||||||||| |||||||||||||||| ||||||| ||| |||| ||||    
33388135 caatcctgtgatccacccaaacttatgcttgttctcacgatgatcccgcccaatagtggtaagagaaggaagttgaggaaaagatttcaagaacttgcaa 33388234  T
303 tgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaac 402  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| | |||  |||||    
33388235 tgctccaaatttaaatatacaagtttggaaagcttcctcaagctaggtagtgtcacaaaatcgtttccccctaaatttaatttttctagtgagtgtaaac 33388334  T
403 attcaattg 411  Q
33388335 attcaattg 33388343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 12 - 411
Target Start/End: Complemental strand, 33644761 - 33644365
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||||| ||||||||| |||||  || ||||||||||||||| | ||||||||||||||||||   ||||| |||  |  ||| || ||||  |||||||    
33644761 tctatttgtattgaataacccacactttgattgttgatccaacttggtatttcacttcctggagttacaatttgagtcctatcaaagtaggttgggtagg 33644662  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | ||| | | ||||| ||||||||||  |||||||||||||||||||||||||||| | ||||||||||      ||||||| | |||||| ||||||||    
33644661 attgtaggtttgcctgaatgaattgtatcatccatgaaaatgtcatgctcctgcaacgttccctctcac------ccaattttgaacagttgaaaatgac 33644568  T
212 caatcctgtagtccac-cat--ttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctcc 308  Q
    |||||||| | ||||  |||  |  ||||||   || |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| || |||    
33644567 caatcctgaaatccagacatcgtcattctcatctcgttcccgcccaatagtggtaggggaaggaagttgaggcaaagattccaacaacttgcagtgttcc 33644468  T
309 aaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaa 408  Q
    ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||   |||||||||||    
33644467 aaatttaaatatacaagtttggaaagcttcctcaggctaggtagtgtcacaaaatagtttccccctaaatttaatctttctagcgaatgtaaacattcaa 33644368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 12 - 389
Target Start/End: Complemental strand, 28870390 - 28870016
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||||| |||||||| |||||||||| |||||||| |||||| | ||||||||||||||||||  |||||||| |||| ||||||||||| || ||||||    
28870390 tctatttgtattgaaccacccatgctctgattgttaatccaacttggtatttcacttcctggagtaacaatattaaacgcatccaaatagacaaggtagg 28870291  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | ||| | ||||||  ||||||||||  |||||||||||||| |||||| |  ||| | ||||||||||      | || || |||||||| |||||||     
28870290 attgtcggtatgcccgaatgaattgtttcatccatgaaaatgccatgctacaacaacgttccctctcac------ctaaatttggacagttgaaaatgat 28870197  T
212 caatcctgtagtccacc---atttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctcc 308  Q
    ||| |||||  ||||     ||||| |||||| |  ||||||||| |||| |||||||||||||||||||||||||||||| ||||||| ||||||||||    
28870196 caaacctgttctccagggatatttgctctcacaattatcccgcccgataggggtaggagaaggaagttgaggcaaagattcaaacaacttgcaatgctcc 28870097  T
309 aaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    |||||||||||| |||||||||||||||||| || |||||| |||||||||||||||||||||| ||| ||||||||||||    
28870096 aaatttaaatattcaagtttggaaagcttcctcaggctaggcagtgtcacaaaatagtttccccgtaagtttaatctttct 28870016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 12 - 411
Target Start/End: Original strand, 33304271 - 33304667
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||||| ||||||||||||||| ||| | ||||||||||||| | ||||||||| ||||||||  |||||| |||| |  ||| ||  | | ||||||||    
33304271 tctatttgtattgaatcacccacgctcttattgttgatccaaattggtatttcatttcctggagtaacaatttgaatccaatcaaaggacgtagggtagg 33304370  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | ||||  | ||||| ||||||||||| || |||||||||||||||||| |||||| | ||||||||||      ||||||| |||||||| |||||||     
33304371 attgtgagtttgcctcaatgaattgtgtcaaccatgaaaatgtcatgctactgcaacgttccctctcac------ccaattttggacagttgaaaatgaa 33304464  T
212 caatcctgtagtcca---ccat---------ttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcg 299  Q
    ||||||||||| |||   |||          ||||||||||||  ||       |||| ||||||||||||||||||||||||||||||||||||||  |    
33304465 caatcctgtaggccagatccagaaatatttgttgttctcacga--at-------aatattggtaggagaaggaagttgaggcaaagattccaacaacatg 33304555  T
300 caatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagctta 399  Q
    ||||||| |||||||||||||||||||||||||||||||| || ||||||||| |||||||||| ||||||| |||| |||||||||||| |||||  ||    
33304556 caatgctgcaaatttaaatatacaagtttggaaagcttcctcaggctaggtagagtcacaaaattgtttccctctaagtttaatctttctagcgagtata 33304655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 128 - 389
Target Start/End: Original strand, 33398957 - 33399215
128 aatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgaccaatcctgtagtccac 227  Q
    ||||||||||  ||||||||||||||||||||| |||||| | ||||||||||      ||||||| | |||||| |||||||||||||||| | ||||     
33398957 aatgaattgtatcatccatgaaaatgtcatgctactgcaacgttccctctcac------ccaattttgaacagttgaaaatgaccaatcctgaaatccag 33399050  T
228 -cat--ttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaa 324  Q
     |||  |  ||||||   || |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| || |||||||||||||||||||    
33399051 tcatcgtcattctcatctcgttcccgcccaatagtggtaggggaaggaagttgaggcaaagattccaacaacttgcagtgttccaaatttaaatatacaa 33399150  T
325 gtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    ||| ||||||||||| || |||||||||||||||||||| |||||||  ||||||||||||||||    
33399151 gttcggaaagcttcctcaggctaggtagtgtcacaaaattgtttccctttaaatttaatctttct 33399215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 246 - 411
Target Start/End: Original strand, 33358885 - 33359050
246 tcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagc 345  Q
    |||| |||||||||||||||| |||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||| || ||    
33358885 tcccacccaatagtggtaggaaaaggaagttgaggcaaagattccaacaacttgcaatgttccaaatttaaatatacaagtttagaaagcttcctcaggc 33358984  T
346 taggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaattg 411  Q
    |||||||||||||||||| ||||||||||||||||||| ||||| || |   ||||||||||||||    
33358985 taggtagtgtcacaaaatcgtttccccctaaatttaatatttctagccaatgtaaacattcaattg 33359050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 231 - 411
Target Start/End: Original strand, 33285621 - 33285801
231 ttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttgg 330  Q
    |||||||||||| |||||  ||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
33285621 ttgttctcacgatgatcctccccaatattggtaggaaaaggaagttgaggcaaagattccaacaacttgcaatgctccaaatttaaatatacaagtttgg 33285720  T
331 aaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaattg 411  Q
    | ||||| | || |||||||||||||||||||| |||||||||||| |||||| ||||| || |   ||||||||||||||    
33285721 acagctttctcaggctaggtagtgtcacaaaattgtttccccctaagtttaatatttctagccaatataaacattcaattg 33285801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 244 - 411
Target Start/End: Original strand, 33271841 - 33272008
244 gatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaa 343  Q
    ||||||||||| |||| |  |||||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| ||     
33271841 gatcccgcccactagtaggtggagaaggaagtcgaggcaaagattccaacaacttgcaatgttccaaatttaaatatacaagtttggaaagcttcctcag 33271940  T
344 gctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaattg 411  Q
    |||||||||||||||||||| |||||||||||||| |||||||||| || |   ||||||||||||||    
33271941 gctaggtagtgtcacaaaattgtttccccctaaatctaatctttctagccaatgtaaacattcaattg 33272008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 256 - 411
Target Start/End: Original strand, 33410033 - 33410188
256 tagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgt 355  Q
    ||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||| ||||||| |||||||||||||||||| |||||||||||||||    
33410033 tagtggtaggaaaaggaagttgaggcaaagattccaacaacttgcaatgctgcaaatctaaatattcaagtttggaaagcttcctcaagctaggtagtgt 33410132  T
356 cacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaattg 411  Q
    |||||||||||||||| |||||| |||||||||| ||||   ||||| ||||||||    
33410133 cacaaaatagtttcccgctaaatataatctttctagcgaatgtaaaccttcaattg 33410188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 122 - 411
Target Start/End: Original strand, 33057463 - 33057752
122 tgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgaccaatcctgta 221  Q
    ||||||||||||||||  ||||||| ||| |||||||||||||||||| ||||||||||      ||||||| |||||||| ||||||| |||||||| |    
33057463 tgccttaatgaattgtttcatccataaaagtgtcatgctcctgcaatgttccctctcac------ccaattttggacagttgaaaatgagcaatcctgca 33057556  T
222 gtccaccat--------ttgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatt 313  Q
      |||| |         | || ||||||| || ||  |||| || |||||||| |||||||||||||||||||||||||||| | |||||||||||||||    
33057557 --ccacaaaaatagtcgtcgtactcacgatgaacctccccagtattggtaggaaaaggaagttgaggcaaagattccaacaatttgcaatgctccaaatt 33057654  T
314 taaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaattg 411  Q
    |||||||||||||||||| ||||||| || |||||||| ||||||||||| ||||||| ||||||||||||||||| || |   ||||||||||||||    
33057655 taaatatacaagtttggatagcttcctcaggctaggtaatgtcacaaaatcgtttcccgctaaatttaatctttctagccaatgtaaacattcaattg 33057752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 140 - 411
Target Start/End: Original strand, 9166667 - 9166935
140 catccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgaccaatcctgtagtccacca---tttgttc 236  Q
    ||||||||||||||||||||| |||||||| ||| | ||||||      ||||  |||||||| ||||||||||||||||| ||| |  |   |||||||    
9166667 catccatgaaaatgtcatgctactgcaatgttccttatcactc------aattctggacagttgaaaatgaccaatcctgttgtcgagaaaaatttgttc 9166760  T
237 tcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagct 336  Q
    |||  | || ||| | | |||||| ||| | ||||||||||||||||| | |||||||||  ||||||||||||||||||||||||||||||||||||||    
9166761 tcattatgagcccactcgatagtgttagaaaaaggaagttgaggcaaaaactccaacaacctgcaatgctccaaatttaaatatacaagtttggaaagct 9166860  T
337 tccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttctggcgagcttaaacattcaattg 411  Q
    ||| |||||||||||||||| |||||| | |||||||||| |||||||||||| || | | ||||||||||||||    
9166861 tcctcaagctaggtagtgtcgcaaaatcgattccccctaagtttaatctttctagccaccgtaaacattcaattg 9166935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 33271582 - 33271782
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    ||||||||||| |||||||||||||| ||||||||||||||| | ||||||||||||||||||   | |||||||||||||| |||||| |             
33271582 tctattggtatcgaatcacccatgctctgattgttgatccaacttggtatttcacttcctggagttataatatgaaactcattcaaataag--------- 33271672  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | || || | |||| |||||||||||  ||||||||||||||||| ||| |||||| | ||||||||||  ||||||||||| |||||||| ||||||||    
33271673 attgcgggtttgccataatgaattgtatcatccatgaaaatgtcaagctactgcaacgttccctctcacagtcagccaattttggacagttgaaaatgac 33271772  T
212 caatcctgta 221  Q
33271773 caatcctgta 33271782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 12 - 180
Target Start/End: Original strand, 33285381 - 33285552
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaatag---gcagggt 108  Q
    |||||||||||||||  ||||| ||| ||||| || |||||| | ||||||||||||||||||  ||||||||||| | | || ||  ||   |||||||    
33285381 tctattggtattgaactacccacgctctgattattaatccaacttggtatttcacttcctggagtaacaatatgaatcccttcaaataaggacgcagggt 33285480  T
109 aggagtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcac 180  Q
    |  ||||| | |||||||  |||||||||  |||||||||||||| |||||| |||||| | ||||| ||||    
33285481 aaaagtgttggtatgcctggatgaattgtatcatccatgaaaatgccatgctactgcaacgttccctttcac 33285552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 12 - 74
Target Start/End: Original strand, 33057365 - 33057427
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctgga 74  Q
    ||||||| |||||||| |||||| || ||||||||||||||| | ||||||||||||||||||    
33057365 tctattgctattgaataacccatcctctgattgttgatccaacttggtatttcacttcctgga 33057427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 12 - 82
Target Start/End: Original strand, 33398859 - 33398929
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaat 82  Q
    |||||| |||||||||||||||  |  ||||||||||||||| | ||||||||||||||||||| ||||||    
33398859 tctatttgtattgaatcacccacacactgattgttgatccaacttggtatttcacttcctggaataacaat 33398929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 15 - 74
Target Start/End: Original strand, 33409768 - 33409827
15 attggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctgga 74  Q
    |||| ||||||| |||||| ||| ||||||||||||||| | ||||||||||||||||||    
33409768 attgatattgaagcacccacgctctgattgttgatccaacttggtatttcacttcctgga 33409827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 33409869 - 33409926
122 tgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctca 179  Q
    ||||| |||||| |||||||||||||||| ||| ||||| |||||| | |||||||||    
33409869 tgcctgaatgaaatgtgccatccatgaaattgtgatgctactgcaacgttccctctca 33409926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1408 (Bit Score: 146; Significance: 9e-77; HSPs: 1)
Name: scaffold1408

Target: scaffold1408; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 12 - 389
Target Start/End: Original strand, 431 - 808
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||||| |||||||| |||||||||| ||||||||||||||  | ||||||||||||||||||  |||||| |||| ||||| |||||| | |  |||||    
431 tctattagtattgaaccacccatgctctgattgttgatccagcttggtatttcacttcctggagtaacaatttgaagctcatacaaatacggaccgtagg 530  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | ||| | | ||||| ||||||||||  ||||||||||||||| ||||| || |||   ||||||||||      ||||||| |||||||| ||||||||    
531 attgttggtttgcctgaatgaattgtttcatccatgaaaatgttatgctactacaacattccctctcac------ccaattttggacagttgaaaatgac 624  T
212 caatcctgtagtccaccatt------tgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgc 305  Q
    ||||||| |||||||  | |      |||||||| ||  |||| ||||||||||| | ||| |||||||||||||||| ||||||||||||| |||||||    
625 caatcctttagtccaataatattcgttgttctcatgataatccggcccaatagtgcttggaaaaggaagttgaggcaacgattccaacaacttgcaatgc 724  T
306 tccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    ||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||  ||||||||||||||||||||||||    
725 tccaaatttaaatatacaagtctggaaagcttcctcatgctaggtagtgtcacaaaattatttccccctaaatttaatctttct 808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0428 (Bit Score: 146; Significance: 9e-77; HSPs: 1)
Name: scaffold0428

Target: scaffold0428; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 12 - 389
Target Start/End: Original strand, 6177 - 6554
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtagg 111  Q
    |||||| |||||||| |||||||||| ||||||||||||||  | ||||||||||||||||||  |||||| |||| ||||| |||||| | |  |||||    
6177 tctattagtattgaaccacccatgctctgattgttgatccagcttggtatttcacttcctggagtaacaatttgaagctcatacaaatacggaccgtagg 6276  T
112 agtgtggatatgccttaatgaattgtgccatccatgaaaatgtcatgctcctgcaatgctccctctcactctcagccaatttcggacagttaaaaatgac 211  Q
    | ||| | | ||||| ||||||||||  ||||||||||||||| ||||| || |||   ||||||||||      ||||||| |||||||| ||||||||    
6277 attgttggtttgcctgaatgaattgtttcatccatgaaaatgttatgctactacaacattccctctcac------ccaattttggacagttgaaaatgac 6370  T
212 caatcctgtagtccaccatt------tgttctcacgacgatcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgc 305  Q
    ||||||| |||||||  | |      |||||||| ||  |||| ||||||||||| | ||| |||||||||||||||| ||||||||||||| |||||||    
6371 caatcctttagtccaataatattcgttgttctcatgataatccggcccaatagtgcttggaaaaggaagttgaggcaacgattccaacaacttgcaatgc 6470  T
306 tccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    ||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||  ||||||||||||||||||||||||    
6471 tccaaatttaaatatacaagtctggaaagcttcctcatgctaggtagtgtcacaaaattatttccccctaaatttaatctttct 6554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 246 - 389
Target Start/End: Complemental strand, 17440870 - 17440727
246 tcccgcccaatagtggtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagc 345  Q
    |||||||| |||| ||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||||||| || ||    
17440870 tcccgcccgatagcggtaggaaaaggaagttgaggcaaagattccaacaacttgcaatgctgcaaatttaaatatacaagtttcgaaagcttcctcaggc 17440771  T
346 taggtagtgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    ||||||||||| ||||||  ||||||||||||||||||||||||    
17440770 taggtagtgtcgcaaaatcatttccccctaaatttaatctttct 17440727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 17441081 - 17441014
20 tattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaa 87  Q
    |||||||||||||| ||| | ||||||||||||| | |||||||| |||||||||  |||||||||||    
17441081 tattgaatcacccacgctcttattgttgatccaacttggtatttcgcttcctggactaacaatatgaa 17441014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 81; Significance: 5e-38; HSPs: 12)
Name: chr4

Target: chr4; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 261 - 389
Target Start/End: Original strand, 31157250 - 31157378
261 gtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaa 360  Q
    |||||| ||||||||||||||||||||||||| | || |||||||||||| ||||||||||||||||||||||||| || || |||||| ||||||||||    
31157250 gtaggaaaaggaagttgaggcaaagattccaaaagcttgcaatgctccaagtttaaatatacaagtttggaaagctccctcaggctaggcagtgtcacaa 31157349  T
361 aatagtttccccctaaatttaatctttct 389  Q
    ||| ||| ||||||| |||||||||||||    
31157350 aattgttcccccctatatttaatctttct 31157378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 261 - 382
Target Start/End: Complemental strand, 31504153 - 31504032
261 gtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaa 360  Q
    ||||||||||||||   |||||||||||||||||  | |||||||||||| ||||||||||||||||||||||||| || || |||||||| ||||||||    
31504153 gtaggagaaggaagaacaggcaaagattccaacagtttgcaatgctccaagtttaaatatacaagtttggaaagctccctcaggctaggtactgtcacaa 31504054  T
361 aatagtttccccctaaatttaa 382  Q
    |||  ||||||||||| |||||    
31504053 aattatttccccctaagtttaa 31504032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 261 - 383
Target Start/End: Complemental strand, 31478968 - 31478846
261 gtaggagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaa 360  Q
    |||||||||||||||  ||||||||||| ||||| || ||||||||| ||  |||||||||||||||| ||||||| || ||  ||||||| ||||||||    
31478968 gtaggagaaggaagtacaggcaaagatttcaacagcttgcaatgctctaagcttaaatatacaagttttgaaagctccctcagactaggtactgtcacaa 31478869  T
361 aatagtttccccctaaatttaat 383  Q
    ||| |||||||||||||||||||    
31478868 aattgtttccccctaaatttaat 31478846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 268 - 382
Target Start/End: Complemental strand, 31499016 - 31498902
268 aaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtt 367  Q
    |||||||||||||||||||||||||||| | |||||| || || |||||| |||||||||||||||| | || || |||||||| ||||||||| | |||    
31499016 aaggaagttgaggcaaagattccaacaatttgcaatgttctaagtttaaacatacaagtttggaaaggtccctcaggctaggtaatgtcacaaacttgtt 31498917  T
368 tccccctaaatttaa 382  Q
31498916 tccccctaaatttaa 31498902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 268 - 389
Target Start/End: Original strand, 31148343 - 31148464
268 aaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagtt 367  Q
    |||||||||||||||| |||| ||||||||  ||||||| ||| ||||||||| ||||| |||| |||||||  | ||||||||  |||||||||| |||    
31148343 aaggaagttgaggcaacgatttcaacaacttacaatgctgcaagtttaaatatgcaagtctggatagcttcctaaggctaggtaccgtcacaaaattgtt 31148442  T
368 tccccctaaatttaatctttct 389  Q
    |||||||| |||||||||||||    
31148443 tccccctagatttaatctttct 31148464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 265 - 384
Target Start/End: Complemental strand, 31472509 - 31472390
265 gagaaggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaata 364  Q
    |||||||||||| ||||||||||| ||||  |  || ||| || || ||||||||||||||||||||||||| || |  |||||||| |||||||||||     
31472509 gagaaggaagtttaggcaaagatttcaactgcgggcgatgttctaagtttaaatatacaagtttggaaagctccctcgggctaggtactgtcacaaaatt 31472410  T
365 gtttccccctaaatttaatc 384  Q
     || || |||| ||||||||    
31472409 attccctcctacatttaatc 31472390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 19 - 158
Target Start/End: Complemental strand, 31472764 - 31472625
19 gtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaaactcatccaaataggcagggtaggagtgtgg 118  Q
    |||| ||||||||| || | |||||||||| |||| | ||||||||||||||||||  |||||| ||||    |||  || || ||||| |||| |||||    
31472764 gtatcgaatcacccttgttctgattgttgaaccaacttggtatttcacttcctggagtaacaatctgaattatatcataacagtcagggaaggattgtgg 31472665  T
119 atatgccttaatgaattgtgccatccatgaaaatgtcatg 158  Q
    || ||||| ||||| ||||  |||||||||||||||||||    
31472664 atttgcctgaatgagttgtatcatccatgaaaatgtcatg 31472625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 389
Target Start/End: Original strand, 31526532 - 31526568
353 tgtcacaaaatagtttccccctaaatttaatctttct 389  Q
    ||||||||||| |||||||||||||||||||||||||    
31526532 tgtcacaaaattgtttccccctaaatttaatctttct 31526568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 12 - 87
Target Start/End: Complemental strand, 31499276 - 31499201
12 tctattggtattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaatatgaa 87  Q
    |||||| |||||||||||||| |||| ||||| || | |||| | | ||||||||||||||||  |||||||||||    
31499276 tctattcgtattgaatcacccttgctctgattcttaaaccaacttgatatttcacttcctggagtaacaatatgaa 31499201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 31157018 - 31157080
20 tattgaatcacccatgctatgattgttgatccaattcggtatttcacttcctggaacaacaat 82  Q
    |||||||||||||  ||| |||||||||| |||| | |||||||||||||| |||| ||||||    
31157018 tattgaatcaccctcgctctgattgttgaaccaaattggtatttcacttccaggaataacaat 31157080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 218
Target Start/End: Original strand, 31157172 - 31157213
177 tcactctcagccaatttcggacagttaaaaatgaccaatcct 218  Q
    ||||||||| ||||||| |||||||| |||||||||||||||    
31157172 tcactctcacccaatttaggacagttgaaaatgaccaatcct 31157213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 109 - 157
Target Start/End: Complemental strand, 31504317 - 31504269
109 aggagtgtggatatgccttaatgaattgtgccatccatgaaaatgtcat 157  Q
    |||| ||||| | ||||||||||||||||  ||||||||||||||||||    
31504317 aggattgtgggtttgccttaatgaattgtatcatccatgaaaatgtcat 31504269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 269 - 387
Target Start/End: Complemental strand, 6785354 - 6785236
269 aggaagttgaggcaaagattccaacaactcgcaatgctccaaatttaaatatacaagtttggaaagcttccacaagctaggtagtgtcacaaaatagttt 368  Q
    |||||| | ||||||| ||| |||||||| ||| || ||||| ||||||||||| ||||||||||||| |  || |||||| | ||||||||||| ||||    
6785354 aggaagatcaggcaaatatttcaacaacttgcagtgatccaagtttaaatatacgagtttggaaagctccttcaggctaggcaatgtcacaaaatggttt 6785255  T
369 ccccctaaatttaatcttt 387  Q
6785254 ccccctaaatttaatcttt 6785236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC