View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9100J-LTR4-TNT-insertion-3 (Length: 414)

Name: F9100J-LTR4-TNT-insertion-3
Description: F9100J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9100J-LTR4-TNT-insertion-3
F9100J-LTR4-TNT-insertion-3
[»] chr6 (2 HSPs)
chr6 (10-404)||(31424914-31425308)
chr6 (318-348)||(34230427-34230457)


Alignment Details
Target: chr6 (Bit Score: 391; Significance: 0; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 391; E-Value: 0
Query Start/End: Original strand, 10 - 404
Target Start/End: Original strand, 31424914 - 31425308
Alignment:
10 catgaacaaaggagaggaggaatatggactaaaagggtcttaaagttgatagaattggtatatcatatattctctatatggattttagatttggggtcac 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31424914 catgaacaaaggagaggaggaatatggactaaaagggtcttaaagttgatagaattggtatatcatatattctctatatggattttagatttggggtcac 31425013  T
110 actcacatgttaggagggtagtagttggagaggagaccaaagtaatttattttgggcaaattcatggacccatatcactagtactagtgggctcactaag 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31425014 actcacatgttaggagggtagtagttggagaggagaccaaagtaatttattttgggcaaattcatggacccatatcactagtactagtgggctcactaag 31425113  T
210 tgaaagtggaagttgttaggtggtcaggtagactaattaccccaccaaattagccaaaatagaagcaaaaccatcaccatttgttcgtaactttgtatga 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
31425114 tgaaagtggaagttgttaggtggtcaggtagactaattaccccaccaaattagccaaaatagaagcaaaaccatcaccatttgtttgtaactttgtatga 31425213  T
310 ttttatatggaaaattgatgttcacacatgttataaggtagaaataaaccattaaatgatcatgatattcctcagcagttaactgtcgatgaatt 404  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31425214 ttttatatggaaaattgatgttcacacatgttataaggtagaaataaaccattaaatgatcatgatattcctcagcagttaactgtcgatgaatt 31425308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 348
Target Start/End: Original strand, 34230427 - 34230457
Alignment:
318 ggaaaattgatgttcacacatgttataaggt 348  Q
    |||||||||||||||||||||||||||||||    
34230427 ggaaaattgatgttcacacatgttataaggt 34230457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC