View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9101J-LTR4-TNT-insertion-1 (Length: 413)

Name: F9101J-LTR4-TNT-insertion-1
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9101J-LTR4-TNT-insertion-1
F9101J-LTR4-TNT-insertion-1
[»] chr4 (1 HSPs)
chr4 (11-404)||(53477986-53478379)


Alignment Details
Target: chr4 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 11 - 404
Target Start/End: Original strand, 53477986 - 53478379
Alignment:
11 caatttgtaggtgtgattagacagaattagagtttttcaagtgtagtttgacatgcttctatcattatgttttacatcaatgacttattcagtgattttc 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53477986 caatttgtaggtgtgattagacagaattagagtttttcaagtgtagtttgacatgcttctatcattatgttttacatcaatgacttattcagtgattttc 53478085  T
111 gtaggaacgtcttccacttctcacgatcaatccacttagttaaacgcatgaagaaaaataacattataagaattgtctcgttagggagaaattgaaagaa 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53478086 gtaggaacgtcttccacttctcacgatcaatccacttagttaaacgcatgaagaaaaataacattataagaattgtctcgttagggagaaattgaaagaa 53478185  T
211 aaataccgaattgaataaagaattacaagaccacaattttattcaaatgattccaagtttaactaaaacatatgatagcttaacacaaataatgacctca 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53478186 aaataccgaattgaataaagaattacaagaccacaattttattcaaatgattccaagtttaactaaaacatatgatagcttaacacaaataatgacctca 53478285  T
311 aaattaagacgttgaaaacctacatatggaagagttatcaatcaatgaaacatttttgttgaatattaagtcaccatgtgagactcttcaattg 404  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53478286 aaattaagacgttgaaaacctacatatggaagagttatcaatcaatgaaacatttttgttgaatattaagtcaccatgtgagactcttcaattg 53478379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC