View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9101J-LTR4-TNT-insertion-1 (Length: 413)

Name: F9101J-LTR4-TNT-insertion-1
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9101J-LTR4-TNT-insertion-1
[»] chr4 (1 HSPs)
chr4 (11-404)||(53477986-53478379)

Alignment Details
Target: chr4 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 11 - 404
Target Start/End: Original strand, 53477986 - 53478379
11 caatttgtaggtgtgattagacagaattagagtttttcaagtgtagtttgacatgcttctatcattatgttttacatcaatgacttattcagtgattttc 110  Q
53477986 caatttgtaggtgtgattagacagaattagagtttttcaagtgtagtttgacatgcttctatcattatgttttacatcaatgacttattcagtgattttc 53478085  T
111 gtaggaacgtcttccacttctcacgatcaatccacttagttaaacgcatgaagaaaaataacattataagaattgtctcgttagggagaaattgaaagaa 210  Q
53478086 gtaggaacgtcttccacttctcacgatcaatccacttagttaaacgcatgaagaaaaataacattataagaattgtctcgttagggagaaattgaaagaa 53478185  T
211 aaataccgaattgaataaagaattacaagaccacaattttattcaaatgattccaagtttaactaaaacatatgatagcttaacacaaataatgacctca 310  Q
53478186 aaataccgaattgaataaagaattacaagaccacaattttattcaaatgattccaagtttaactaaaacatatgatagcttaacacaaataatgacctca 53478285  T
311 aaattaagacgttgaaaacctacatatggaagagttatcaatcaatgaaacatttttgttgaatattaagtcaccatgtgagactcttcaattg 404  Q
53478286 aaattaagacgttgaaaacctacatatggaagagttatcaatcaatgaaacatttttgttgaatattaagtcaccatgtgagactcttcaattg 53478379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 78122 times since January 2019
Visitors: 2276