View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9101J-LTR4-TNT-insertion-2 (Length: 397)

Name: F9101J-LTR4-TNT-insertion-2
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9101J-LTR4-TNT-insertion-2
F9101J-LTR4-TNT-insertion-2
[»] chr1 (2 HSPs)
chr1 (8-387)||(49807572-49807951)
chr1 (127-272)||(49800067-49800215)
[»] chr5 (2 HSPs)
chr5 (127-293)||(36171808-36171977)
chr5 (29-84)||(36171993-36172048)
[»] chr6 (1 HSPs)
chr6 (127-293)||(2374047-2374216)


Alignment Details
Target: chr1 (Bit Score: 380; Significance: 0; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 8 - 387
Target Start/End: Original strand, 49807572 - 49807951
Alignment:
8 aaggtgtggaatttgagaaggaggagaggtgttgctggagagaatgaaaaggagttgaaaattgatgagaaaaaacctatcggttcgtcgccgttaagga 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49807572 aaggtgtggaatttgagaaggaggagaggtgttgctggagagaatgaaaaggagttgaaaattgatgagaaaaaacctatcggttcgtcgccgttaagga 49807671  T
108 atggtaacggcgttggtaagttaagaggtggtggttctcctgagaagaaggtgaaattttctttgtcattgatgaagaaggagattgaagaagatttcat 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49807672 atggtaacggcgttggtaagttaagaggtggtggttctcctgagaagaaggtgaaattttctttgtcattgatgaagaaggagattgaagaagatttcat 49807771  T
208 cacgatgactggtcaaaagcctcatagaaggcccaaaaagagacctagaaatgttcagaagcaaatggatgtaagttgatttaattagtactaactacta 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49807772 cacgatgactggtcaaaagcctcatagaaggcccaaaaagagacctagaaatgttcagaagcaaatggatgtaagttgatttaattagtactaactacta 49807871  T
308 atcctaatttttaatttcattttgattgtaatgttcatttgtgcagaccctttttcctggtatgtggttgtctgagatta 387  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49807872 atcctaatttttaatttcattttgattgtaatgttcatttgtgcagaccctttttcctggtatgtggttgtctgagatta 49807951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 127 - 272
Target Start/End: Original strand, 49800067 - 49800215
Alignment:
127 gttaagaggtggtggttctcctgagaagaagg---tgaaattttctttgtcattgatgaagaaggagattgaagaagatttcatcacgatgactggtcaa 223  Q
    ||||| ||||||||||||| |||||||||||    |||| ||||||||||| || |  |||||||||||||| ||||||||||||| |||||| ||||||    
49800067 gttaaaaggtggtggttctactgagaagaagacgatgaagttttctttgtcgttaacaaagaaggagattgaggaagatttcatcaagatgacaggtcaa 49800166  T
224 aagcctcatagaaggcccaaaaagagacctagaaatgttcagaagcaaa 272  Q
    ||||||| |||||||||||||| | |||||| |||||||||||||||||    
49800167 aagcctcctagaaggcccaaaaggggacctaaaaatgttcagaagcaaa 49800215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 96; Significance: 6e-47; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 127 - 293
Target Start/End: Complemental strand, 36171977 - 36171808
Alignment:
127 gttaagaggtggtggttctcctgagaagaagg---tgaaattttctttgtcattgatgaagaaggagattgaagaagatttcatcacgatgactggtcaa 223  Q
    ||||| ||||||||||||| ||||||||||||   |||| ||||||||||| ||||  |||||||||||||| |||||||||||||  ||||| ||||||    
36171977 gttaaaaggtggtggttctactgagaagaaggcgatgaagttttctttgtcgttgacaaagaaggagattgaggaagatttcatcaaaatgacaggtcaa 36171878  T
224 aagcctcatagaaggcccaaaaagagacctagaaatgttcagaagcaaatggatgtaagttgatttaatt 293  Q
    ||||||| |||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||| ||||    
36171877 aagcctcctagaaggcccaaaaggagacctaaaaatgttcagaagcaaatgaatgtaagttgattcaatt 36171808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 36172048 - 36171993
Alignment:
29 aggagaggtgttgctggagagaatgaaaaggagttgaaaattgatgagaaaaaacc 84  Q
    ||||||||||||||||||||||  | ||||| |||||| |||||||||||||||||    
36172048 aggagaggtgttgctggagagaccggaaaggggttgaagattgatgagaaaaaacc 36171993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 127 - 293
Target Start/End: Complemental strand, 2374216 - 2374047
Alignment:
127 gttaagaggtggtggttctcctgagaagaagg---tgaaattttctttgtcattgatgaagaaggagattgaagaagatttcatcacgatgactggtcaa 223  Q
    ||||| |||||| |||||| ||||||||||||   |||| ||||||||||| ||||  |||||||||||||| ||||||||||||| |||||| ||||||    
2374216 gttaaaaggtggcggttctactgagaagaaggcgatgaagttttctttgtcgttgacaaagaaggagattgaggaagatttcatcaagatgacaggtcaa 2374117  T
224 aagcctcatagaaggcccaaaaagagacctagaaatgttcagaagcaaatggatgtaagttgatttaatt 293  Q
    | |||||  ||||||||||||| |||| ||| ||||||||||||| ||||| ||||||||||||| ||||    
2374116 atgcctcccagaaggcccaaaaggagatctaaaaatgttcagaagaaaatgaatgtaagttgattcaatt 2374047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 94937 times since January 2019
Visitors: 2222