View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9101J-LTR4-TNT-insertion-2 (Length: 397)

Name: F9101J-LTR4-TNT-insertion-2
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9101J-LTR4-TNT-insertion-2
[»] chr1 (2 HSPs)
chr1 (8-387)||(49807572-49807951)
chr1 (127-272)||(49800067-49800215)
[»] chr5 (2 HSPs)
chr5 (127-293)||(36171808-36171977)
chr5 (29-84)||(36171993-36172048)
[»] chr6 (1 HSPs)
chr6 (127-293)||(2374047-2374216)

Alignment Details
Target: chr1 (Bit Score: 380; Significance: 0; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 8 - 387
Target Start/End: Original strand, 49807572 - 49807951
8 aaggtgtggaatttgagaaggaggagaggtgttgctggagagaatgaaaaggagttgaaaattgatgagaaaaaacctatcggttcgtcgccgttaagga 107  Q
49807572 aaggtgtggaatttgagaaggaggagaggtgttgctggagagaatgaaaaggagttgaaaattgatgagaaaaaacctatcggttcgtcgccgttaagga 49807671  T
108 atggtaacggcgttggtaagttaagaggtggtggttctcctgagaagaaggtgaaattttctttgtcattgatgaagaaggagattgaagaagatttcat 207  Q
49807672 atggtaacggcgttggtaagttaagaggtggtggttctcctgagaagaaggtgaaattttctttgtcattgatgaagaaggagattgaagaagatttcat 49807771  T
208 cacgatgactggtcaaaagcctcatagaaggcccaaaaagagacctagaaatgttcagaagcaaatggatgtaagttgatttaattagtactaactacta 307  Q
49807772 cacgatgactggtcaaaagcctcatagaaggcccaaaaagagacctagaaatgttcagaagcaaatggatgtaagttgatttaattagtactaactacta 49807871  T
308 atcctaatttttaatttcattttgattgtaatgttcatttgtgcagaccctttttcctggtatgtggttgtctgagatta 387  Q
49807872 atcctaatttttaatttcattttgattgtaatgttcatttgtgcagaccctttttcctggtatgtggttgtctgagatta 49807951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 127 - 272
Target Start/End: Original strand, 49800067 - 49800215
127 gttaagaggtggtggttctcctgagaagaagg---tgaaattttctttgtcattgatgaagaaggagattgaagaagatttcatcacgatgactggtcaa 223  Q
    ||||| ||||||||||||| |||||||||||    |||| ||||||||||| || |  |||||||||||||| ||||||||||||| |||||| ||||||    
49800067 gttaaaaggtggtggttctactgagaagaagacgatgaagttttctttgtcgttaacaaagaaggagattgaggaagatttcatcaagatgacaggtcaa 49800166  T
224 aagcctcatagaaggcccaaaaagagacctagaaatgttcagaagcaaa 272  Q
    ||||||| |||||||||||||| | |||||| |||||||||||||||||    
49800167 aagcctcctagaaggcccaaaaggggacctaaaaatgttcagaagcaaa 49800215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 96; Significance: 6e-47; HSPs: 2)
Name: chr5

Target: chr5; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 127 - 293
Target Start/End: Complemental strand, 36171977 - 36171808
127 gttaagaggtggtggttctcctgagaagaagg---tgaaattttctttgtcattgatgaagaaggagattgaagaagatttcatcacgatgactggtcaa 223  Q
    ||||| ||||||||||||| ||||||||||||   |||| ||||||||||| ||||  |||||||||||||| |||||||||||||  ||||| ||||||    
36171977 gttaaaaggtggtggttctactgagaagaaggcgatgaagttttctttgtcgttgacaaagaaggagattgaggaagatttcatcaaaatgacaggtcaa 36171878  T
224 aagcctcatagaaggcccaaaaagagacctagaaatgttcagaagcaaatggatgtaagttgatttaatt 293  Q
    ||||||| |||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||| ||||    
36171877 aagcctcctagaaggcccaaaaggagacctaaaaatgttcagaagcaaatgaatgtaagttgattcaatt 36171808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 36172048 - 36171993
29 aggagaggtgttgctggagagaatgaaaaggagttgaaaattgatgagaaaaaacc 84  Q
    ||||||||||||||||||||||  | ||||| |||||| |||||||||||||||||    
36172048 aggagaggtgttgctggagagaccggaaaggggttgaagattgatgagaaaaaacc 36171993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 127 - 293
Target Start/End: Complemental strand, 2374216 - 2374047
127 gttaagaggtggtggttctcctgagaagaagg---tgaaattttctttgtcattgatgaagaaggagattgaagaagatttcatcacgatgactggtcaa 223  Q
    ||||| |||||| |||||| ||||||||||||   |||| ||||||||||| ||||  |||||||||||||| ||||||||||||| |||||| ||||||    
2374216 gttaaaaggtggcggttctactgagaagaaggcgatgaagttttctttgtcgttgacaaagaaggagattgaggaagatttcatcaagatgacaggtcaa 2374117  T
224 aagcctcatagaaggcccaaaaagagacctagaaatgttcagaagcaaatggatgtaagttgatttaatt 293  Q
    | |||||  ||||||||||||| |||| ||| ||||||||||||| ||||| ||||||||||||| ||||    
2374116 atgcctcccagaaggcccaaaaggagatctaaaaatgttcagaagaaaatgaatgtaagttgattcaatt 2374047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC