View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9101J-LTR4-TNT-insertion-7 (Length: 265)

Name: F9101J-LTR4-TNT-insertion-7
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9101J-LTR4-TNT-insertion-7
[»] chr8 (2 HSPs)
chr8 (10-259)||(14125626-14125875)
chr8 (10-259)||(14115305-14115545)
[»] scaffold0695 (1 HSPs)
scaffold0695 (10-259)||(4753-5002)

Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr8

Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 10 - 259
Target Start/End: Complemental strand, 14125875 - 14125626
10 aacaagaaaatagagaaaatgcctcacgtactagcaagcaacaaatccctaaacatgggcaacttattagaaaagcaactaaaacagaaacataaaaata 109  Q
14125875 aacaagaaaatagagaaaatgcctcacgtactagcaagcaacaaatccctaaacatgggcaacttattagaaaagcaactaaaacagaaacataaaaata 14125776  T
110 gcaaactgatgaatgcttcttgcagctagtacttttaaagttcaatgtggtcatagctaccattgtcttcatctggatgatccttatgagtatgaagatc 209  Q
14125775 gcaaactgatgaatgcttcttgcagctagtacttttaaagttcaatgtggtcatagctaccattgtcttcatctggatgatccttatgagtatgaagatc 14125676  T
210 aagcctaccattgttgcgtggcagtatcttcttcaacgaaggccaattgg 259  Q
14125675 aagcctaccattgttgcgtggcagtatcttcttcaacgaaggccaattgg 14125626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 10 - 259
Target Start/End: Complemental strand, 14115545 - 14115305
10 aacaagaaaatagagaaaatgcctcacgtactagcaagcaacaaatccctaaacatgggcaacttattagaaaagcaactaaaacagaaacataaaaata 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
14115545 aacaagaaaatagagaaaatgcctcacgtactagcaagcaacaaatccctaaacatgggcaacttaatagaaaagcaactaaaacagaaacataaaaata 14115446  T
110 gcaaactgatgaatgcttcttgcagctagtacttttaaagttcaatgtggtcatagctaccattgtcttcatctggatgatccttatgagtatgaagatc 209  Q
    ||||||||||||||||| ||||||||||||||||||||||||||| | ||         |||| ||||||||||| |||||||||||||| | |||| ||    
14115445 gcaaactgatgaatgctccttgcagctagtacttttaaagttcaacgggg---------ccatagtcttcatctgtatgatccttatgagaacgaaggtc 14115355  T
210 aagcctaccattgttgcgtggcagtatcttcttcaacgaaggccaattgg 259  Q
    |||||||||||||| ||||||||||||  |  ||||||| ||||||||||    
14115354 aagcctaccattgtcgcgtggcagtatgctgctcaacgagggccaattgg 14115305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0695 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: scaffold0695

Target: scaffold0695; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 10 - 259
Target Start/End: Original strand, 4753 - 5002
10 aacaagaaaatagagaaaatgcctcacgtactagcaagcaacaaatccctaaacatgggcaacttattagaaaagcaactaaaacagaaacataaaaata 109  Q
4753 aacaagaaaatagagaaaatgcctcacgtactagcaagcaacaaatccctaaacatgggcaacttattagaaaagcaactaaaacagaaacataaaaata 4852  T
110 gcaaactgatgaatgcttcttgcagctagtacttttaaagttcaatgtggtcatagctaccattgtcttcatctggatgatccttatgagtatgaagatc 209  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4853 gcaaactgatgaatgctccttgcagctagtacttttaaagttcaatgtggtcatagctaccattgtcttcatctggatgatccttatgagtatgaagatc 4952  T
210 aagcctaccattgttgcgtggcagtatcttcttcaacgaaggccaattgg 259  Q
4953 aagcctaccattgttgcgtggcagtatcttcttcaacgaaggccaattgg 5002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98104 times since January 2019
Visitors: 2269