View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9101J-LTR4-TNT-insertion-7 (Length: 265)

Name: F9101J-LTR4-TNT-insertion-7
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9101J-LTR4-TNT-insertion-7
F9101J-LTR4-TNT-insertion-7
[»] chr8 (2 HSPs)
chr8 (10-259)||(14125626-14125875)
chr8 (10-259)||(14115305-14115545)
[»] scaffold0695 (1 HSPs)
scaffold0695 (10-259)||(4753-5002)


Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 10 - 259
Target Start/End: Complemental strand, 14125875 - 14125626
Alignment:
10 aacaagaaaatagagaaaatgcctcacgtactagcaagcaacaaatccctaaacatgggcaacttattagaaaagcaactaaaacagaaacataaaaata 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14125875 aacaagaaaatagagaaaatgcctcacgtactagcaagcaacaaatccctaaacatgggcaacttattagaaaagcaactaaaacagaaacataaaaata 14125776  T
110 gcaaactgatgaatgcttcttgcagctagtacttttaaagttcaatgtggtcatagctaccattgtcttcatctggatgatccttatgagtatgaagatc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14125775 gcaaactgatgaatgcttcttgcagctagtacttttaaagttcaatgtggtcatagctaccattgtcttcatctggatgatccttatgagtatgaagatc 14125676  T
210 aagcctaccattgttgcgtggcagtatcttcttcaacgaaggccaattgg 259  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
14125675 aagcctaccattgttgcgtggcagtatcttcttcaacgaaggccaattgg 14125626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 10 - 259
Target Start/End: Complemental strand, 14115545 - 14115305
Alignment:
10 aacaagaaaatagagaaaatgcctcacgtactagcaagcaacaaatccctaaacatgggcaacttattagaaaagcaactaaaacagaaacataaaaata 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
14115545 aacaagaaaatagagaaaatgcctcacgtactagcaagcaacaaatccctaaacatgggcaacttaatagaaaagcaactaaaacagaaacataaaaata 14115446  T
110 gcaaactgatgaatgcttcttgcagctagtacttttaaagttcaatgtggtcatagctaccattgtcttcatctggatgatccttatgagtatgaagatc 209  Q
    ||||||||||||||||| ||||||||||||||||||||||||||| | ||         |||| ||||||||||| |||||||||||||| | |||| ||    
14115445 gcaaactgatgaatgctccttgcagctagtacttttaaagttcaacgggg---------ccatagtcttcatctgtatgatccttatgagaacgaaggtc 14115355  T
210 aagcctaccattgttgcgtggcagtatcttcttcaacgaaggccaattgg 259  Q
    |||||||||||||| ||||||||||||  |  ||||||| ||||||||||    
14115354 aagcctaccattgtcgcgtggcagtatgctgctcaacgagggccaattgg 14115305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0695 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: scaffold0695
Description:

Target: scaffold0695; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 10 - 259
Target Start/End: Original strand, 4753 - 5002
Alignment:
10 aacaagaaaatagagaaaatgcctcacgtactagcaagcaacaaatccctaaacatgggcaacttattagaaaagcaactaaaacagaaacataaaaata 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4753 aacaagaaaatagagaaaatgcctcacgtactagcaagcaacaaatccctaaacatgggcaacttattagaaaagcaactaaaacagaaacataaaaata 4852  T
110 gcaaactgatgaatgcttcttgcagctagtacttttaaagttcaatgtggtcatagctaccattgtcttcatctggatgatccttatgagtatgaagatc 209  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4853 gcaaactgatgaatgctccttgcagctagtacttttaaagttcaatgtggtcatagctaccattgtcttcatctggatgatccttatgagtatgaagatc 4952  T
210 aagcctaccattgttgcgtggcagtatcttcttcaacgaaggccaattgg 259  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
4953 aagcctaccattgttgcgtggcagtatcttcttcaacgaaggccaattgg 5002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC