View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9101J-LTR4-TNT-insertion-8 (Length: 650)

Name: F9101J-LTR4-TNT-insertion-8
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9101J-LTR4-TNT-insertion-8
F9101J-LTR4-TNT-insertion-8
[»] chr4 (20 HSPs)
chr4 (8-640)||(36419242-36419874)
chr4 (368-622)||(36429253-36429507)
chr4 (357-622)||(36435706-36435971)
chr4 (370-618)||(36376212-36376460)
chr4 (368-622)||(36407098-36407352)
chr4 (370-622)||(36399641-36399893)
chr4 (8-318)||(36407379-36407694)
chr4 (8-318)||(36412502-36412817)
chr4 (84-305)||(36399937-36400158)
chr4 (370-622)||(36370416-36370688)
chr4 (357-618)||(36389456-36389718)
chr4 (107-288)||(36436019-36436200)
chr4 (107-288)||(36376521-36376702)
chr4 (109-318)||(36401218-36401427)
chr4 (368-530)||(36412313-36412475)
chr4 (111-288)||(36429557-36429734)
chr4 (51-282)||(36370762-36370993)
chr4 (8-280)||(36389765-36390045)
chr4 (8-61)||(36376747-36376800)
chr4 (8-61)||(36436257-36436310)
[»] chr8 (6 HSPs)
chr8 (439-509)||(15697353-15697423)
chr8 (422-511)||(15799843-15799932)
chr8 (439-511)||(15805392-15805464)
chr8 (422-509)||(15703715-15703802)
chr8 (422-509)||(15722546-15722633)
chr8 (213-274)||(19357642-19357703)
[»] chr7 (5 HSPs)
chr7 (236-274)||(20285109-20285147)
chr7 (235-274)||(19939301-19939340)
chr7 (235-274)||(19970440-19970479)
chr7 (236-274)||(20294826-20294864)
chr7 (236-273)||(20273976-20274013)
[»] chr2 (5 HSPs)
chr2 (421-539)||(2662470-2662588)
chr2 (236-274)||(2716914-2716952)
chr2 (237-274)||(2711998-2712035)
chr2 (237-274)||(2723538-2723575)
chr2 (237-274)||(2745368-2745405)
[»] chr3 (1 HSPs)
chr3 (427-464)||(13855176-13855213)
[»] chr5 (1 HSPs)
chr5 (235-271)||(469810-469846)


Alignment Details
Target: chr4 (Bit Score: 633; Significance: 0; HSPs: 20)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 633; E-Value: 0
Query Start/End: Original strand, 8 - 640
Target Start/End: Complemental strand, 36419874 - 36419242
Alignment:
8 ccatagtgtccacacctacaaatgcataacataatgattaaataagtacatcatgcaccattaaattatcggccaattttaaggccactctttttattat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36419874 ccatagtgtccacacctacaaatgcataacataatgattaaataagtacatcatgcaccattaaattatcggccaattttaaggccactctttttattat 36419775  T
108 atataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataac 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36419774 atataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataac 36419675  T
208 tgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatagctatagcatcataaaaata 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36419674 tgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatagctatagcatcataaaaata 36419575  T
308 cagatcaatctctaaagccactacaactttacaaaatagttggagtatcataagggcatcacacatactatgttccaacaactctttttgttctagcttg 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36419574 cagatcaatctctaaagccactacaactttacaaaatagttggagtatcataagggcatcacacatactatgttccaacaactctttttgttctagcttg 36419475  T
408 aatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatgg 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36419474 aatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatgg 36419375  T
508 attattttcagccttgaatcttgatgaagatataatacacctcgagcaatcccacaaataatttcaaaacgcgtaacccaatccaatgatgacctttggt 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36419374 attattttcagccttgaatcttgatgaagatataatacacctcgagcaatcccacaaataatttcaaaacgcgtaacccaatccaatgatgacctttggt 36419275  T
608 tttgatctgagttgagcatattagcaatcatta 640  Q
    |||||||||||||||||||||||||||||||||    
36419274 tttgatctgagttgagcatattagcaatcatta 36419242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 368 - 622
Target Start/End: Complemental strand, 36429507 - 36429253
Alignment:
368 acacatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattac 467  Q
    |||| ||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |    
36429507 acacctactatgttccgaccactctttttgttcttgcttgaatttcatcttctccaaatattctagccataccaaaatctgagattttgggattcattgc 36429408  T
468 agcatcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatacacctcgagcaatcccacaaata 567  Q
    |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
36429407 agcatcgaggagaacgttgctggcttttagatctctatgaattattttcagccttgaatcttgatgaagatataaaacacctcgagcaatcccacaaata 36429308  T
568 atttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgagttga 622  Q
    |||||||||||| | |||||||||||||| |||||||||||||||||||||||||    
36429307 atttcaaaacgctttacccaatccaatgacgacctttggttttgatctgagttga 36429253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 357 - 622
Target Start/End: Complemental strand, 36435971 - 36435706
Alignment:
357 ataagggcatcacacatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttg 456  Q
    ||||||| || | ||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||    
36435971 ataagggtatgaaacatactatgttccaaccactctttttgttcttgcttgtatttcatcttctccaaatattctagccataccaaaatctgagattttg 36435872  T
457 ggattcattacagcatcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatacacctcgagcaa 556  Q
    ||||||||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||    
36435871 ggattcattgcagcatcaaggagaacattgctggcttttagatctctatgaattattttcagccttgaatcttgatgaagatataaaacacctcgagcaa 36435772  T
557 tcccacaaataatttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgagttga 622  Q
    | ||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||    
36435771 tgccacaaataatttcaaaacgcttaccccaatccaataatgacctttggttttgatctgagttga 36435706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 370 - 618
Target Start/End: Complemental strand, 36376460 - 36376212
Alignment:
370 acatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattacag 469  Q
    ||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||    
36376460 acatactatgttccaaccactctttttgttcttgcttgtatttcatcttctccaaatattctagccataccaaaatctgagattttgggattcattgcag 36376361  T
470 catcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatacacctcgagcaatcccacaaataat 569  Q
    |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
36376360 catcgaggagaacgttgctggcttttagatctctatgaattattttcagccttgaatcttgatgaagatataaaacacctcgagcaatcccacaaataat 36376261  T
570 ttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgag 618  Q
    |||||||||| |  |||||||||||||||||||||||||||||||||||    
36376260 ttcaaaacgctttccccaatccaatgatgacctttggttttgatctgag 36376212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 368 - 622
Target Start/End: Complemental strand, 36407352 - 36407098
Alignment:
368 acacatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattac 467  Q
    |||||||||||||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |    
36407352 acacatactatgttccgaccactctttttgttcttgcttggatttcatcttctccaaatattctagccataccaaaatctgagattttgggattcattgc 36407253  T
468 agcatcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatacacctcgagcaatcccacaaata 567  Q
    ||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||     
36407252 agcgtcaaggagaacattgctggcttttagatctctatgaattattttcagccttgaatcttggtgaagatataaaacacctcgagcaatcccacaaatg 36407153  T
568 atttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgagttga 622  Q
    |||||||||||| | ||||||||||||||||||||||||||||||||||||||||    
36407152 atttcaaaacgctttacccaatccaatgatgacctttggttttgatctgagttga 36407098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 370 - 622
Target Start/End: Complemental strand, 36399893 - 36399641
Alignment:
370 acatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattacag 469  Q
    |||||||||||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||    
36399893 acatactatgttccgaccactctttttgttcttgcttggatttcatcttctccaaatattctagccataccgaaatctgagattttgggattcatttcag 36399794  T
470 catcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatacacctcgagcaatcccacaaataat 569  Q
    ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||    
36399793 catcaaggagaacattgctggcttttagatctctatgaattattttcagccttgaatcttggtgaagatataaaacacctcgagcaatgccacaaataat 36399694  T
570 ttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgagttga 622  Q
    |||||||||| || |||||||||||||||||||||||||||||||||||||||    
36399693 ttcaaaacgcttaccccaatccaatgatgacctttggttttgatctgagttga 36399641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 8 - 318
Target Start/End: Complemental strand, 36407694 - 36407379
Alignment:
8 ccatagtgtccacacctacaaatgcataacataatgattaaataagta---cat--catgcaccattaaattatcggccaattttaaggccactcttttt 102  Q
    |||||||||||||||||| ||||||| |||| |||  |||||||| ||   |||  |||||| ||||| ||| | ||||||||||||||| |||||||||    
36407694 ccatagtgtccacacctataaatgcacaacacaatttttaaataaatatgtcatgtcatgcatcattagattgttggccaattttaaggctactcttttt 36407595  T
103 attatatataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagacccc 202  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||  | ||||||||||||||||||||||||||||||||||||||||||||||||||    
36407594 attatatgtaacttacatgtccaattaaatttggggagtctcttccaatttcacaatgtgtgtttctcttgccagcaataatctccagtagtaagacccc 36407495  T
203 ataactgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatagctatagcatcataa 302  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||| ||||||| | || || |||||||    
36407494 ataactgaagacatcagattttgttgaatatcgtccttccattgcatattctggtgacatatatccactgcaattaaacaaaatggttagagtatcataa 36407395  T
303 aaatacagatcaatct 318  Q
    ||||||| ||| ||||    
36407394 aaatacatatccatct 36407379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 8 - 318
Target Start/End: Complemental strand, 36412817 - 36412502
Alignment:
8 ccatagtgtccacacctacaaatgcataacataatgattaaataagta---cat--catgcaccattaaattatcggccaattttaaggccactcttttt 102  Q
    |||||||||||||||||| ||||||| |||| |||  |||||||| ||   |||  |||||| ||||| ||| | ||||||||||||||| |||||||||    
36412817 ccatagtgtccacacctataaatgcacaacacaatttttaaataaatatgtcatgtcatgcatcattagattgttggccaattttaaggctactcttttt 36412718  T
103 attatatataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagacccc 202  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||  | ||||||||||||||||||||||||||||||||||||||||||||||||||    
36412717 attatatgtaacttacatgtccaattaaatttggggagtctcttccaatttcacaatgtgtgtttctcttgccagcaataatctccagtagtaagacccc 36412618  T
203 ataactgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatagctatagcatcataa 302  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||| ||||||| | || || |||||||    
36412617 ataactgaagacatcagattttgttgaatatcgtccttccattgcatattctggtgacatatatccactgcaattaaacaaaatggttagagtatcataa 36412518  T
303 aaatacagatcaatct 318  Q
    ||||||| ||| ||||    
36412517 aaatacatatccatct 36412502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 166; E-Value: 2e-88
Query Start/End: Original strand, 84 - 305
Target Start/End: Complemental strand, 36400158 - 36399937
Alignment:
84 ttttaaggccactctttttattatatataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataa 183  Q
    ||||||||| |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||  | |||||||||||||||||||||||||||||||    
36400158 ttttaaggctactctttttaatatatttaacttacatgtccaattaaatttggggagtctcttccaatttcacaatgtgtgtttctcttgccagcaataa 36400059  T
184 tctccagtagtaagaccccataactgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaa 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||| ||||||||||||||||||||    
36400058 tctccagtagtaagaccccataactgaagacatcagattttgttgaatatcgtccttccattgcatattcgggtgacatgtatccactgcaattatacaa 36399959  T
284 aatagctatagcatcataaaaa 305  Q
    ||| | || || ||||||||||    
36399958 aatggttagagtatcataaaaa 36399937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 370 - 622
Target Start/End: Complemental strand, 36370688 - 36370416
Alignment:
370 acatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattacag 469  Q
    |||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||    
36370688 acatactatgttccgaccactctttttgttcttgcttgaatttcatcttctccaaatattctagccataccaaaatctgagattttgggattcatttcag 36370589  T
470 catcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatac--------------------acct 549  Q
    ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||                     |||    
36370588 catcaaggagaacattgctggcttttagatctctatgaattattttcagccttgaatcttggtgaagatataaaacgcttaacccaaataatttcagcct 36370489  T
550 cgagcaatcccacaaataatttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgagttga 622  Q
    ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||    
36370488 cgagcaatcacacaaataatttcaaaacgcttaacccaatccaatgatgacctttgattttgatctgagttga 36370416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 148; E-Value: 9e-78
Query Start/End: Original strand, 357 - 618
Target Start/End: Complemental strand, 36389718 - 36389456
Alignment:
357 ataagggcatcacacatactatgttccaacaactctttttgttctagcttgaatttcatcttc---tccaaatattctagccataccaaaatccgagatt 453  Q
    ||||||| || | ||||||||||||||||| |||||||||||| | ||||| |||||||| ||   ||||||||||||||||||||||||||| ||||||    
36389718 ataagggtatgagacatactatgttccaaccactctttttgttattgcttggatttcatcatcgtctccaaatattctagccataccaaaatctgagatt 36389619  T
454 ttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatacacctcgag 553  Q
    || || |||||| |||| ||||||||||| |||||||||||||| |||||||| || |||||||||||||||||||||||||||||||| || |||||||    
36389618 ttagggttcattgcagcgtcaaggagaacattgctggcttttaggtctctatgaatgattttcagccttgaatcttgatgaagatataaaacgcctcgag 36389519  T
554 caatcccacaaataatttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgag 618  Q
    |||||||||  ||||||||||||||  |  |||||||||||||||||||||||||||||||||||    
36389518 caatcccac--ataatttcaaaacgtttgccccaatccaatgatgacctttggttttgatctgag 36389456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 107 - 288
Target Start/End: Complemental strand, 36436200 - 36436019
Alignment:
107 tatataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataa 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||||||| || ||| ||    
36436200 tatataacttacatgtccaattaaatttggggagtctcttcctgtttcacaatgtgtgtttctttggccagcaataatctccagtagtaaaacaccaaaa 36436101  T
207 ctgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatag 288  Q
    ||||||||||| ||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||    
36436100 ctgaagacatccgatttagttgaatatcgtccttccattgcatattccggtgacatatatccactgcaattatacaaaatag 36436019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 138; E-Value: 8e-72
Query Start/End: Original strand, 107 - 288
Target Start/End: Complemental strand, 36376702 - 36376521
Alignment:
107 tatataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataa 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | ||| |||||||||||||||||||| || ||| ||    
36376702 tatataacttacatgtccaattaaatttggggagtctcttcctgtttcacaatgtgtgtttctttggccggcaataatctccagtagtaaaacaccaaaa 36376603  T
207 ctgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatag 288  Q
    ||||||||||| ||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||    
36376602 ctgaagacatccgatttagttgaatatcgtccttccattgcatattccggtgacatatatccactgcaattatacaaaatag 36376521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 130; E-Value: 5e-67
Query Start/End: Original strand, 109 - 318
Target Start/End: Complemental strand, 36401427 - 36401218
Alignment:
109 tataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataact 208  Q
    |||||||||||||||||||||||||||||||  |||||||||| ||||||||||||||||| |  |||||||||||||| || |||||||||||||||||    
36401427 tataacttacatgtccaattaaatttggggaagctcttcctgtttcacaatgtgtgtttctttgaccagcaataatctctagcagtaagaccccataact 36401328  T
209 gaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatagctatagcatcataaaaatac 308  Q
     |||||||||||||| |||||||||||||||| |||||||||||| || ||||||||||||||||||||| ||||||| | || || |||||||||||||    
36401327 aaagacatcagatttcgttgaatatcgtccttccattgcatattctggtgacatatatccactgcaattaaacaaaatggttagagtatcataaaaatac 36401228  T
309 agatcaatct 318  Q
    | ||| ||||    
36401227 atatccatct 36401218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 368 - 530
Target Start/End: Complemental strand, 36412475 - 36412313
Alignment:
368 acacatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattac 467  Q
    |||||||||||||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |    
36412475 acacatactatgttccgaccactctttttgttcttgcttggatttcatcttctccaaatattctagccataccaaaatctgagattttgggattcattgc 36412376  T
468 agcatcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttg 530  Q
    ||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||    
36412375 agcgtcaaggagaacattgctggcttttagatctctatgaattattttcagccttgaatcttg 36412313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 111 - 288
Target Start/End: Complemental strand, 36429734 - 36429557
Alignment:
111 taacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataactga 210  Q
    ||||||||||||||||||||||||||||| ||||||||| | ||||||||||||||||| | |||||||||| |||||||||||| ||||||||||||||    
36429734 taacttacatgtccaattaaatttggggattctcttcctttttcacaatgtgtgtttctttggccagcaatagtctccagtagtatgaccccataactga 36429635  T
211 agacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatag 288  Q
    ||||||||||||| |||||||||||||||| |||||||||||| || ||||||||||| |||||||||| ||||||||    
36429634 agacatcagatttcgttgaatatcgtccttccattgcatattctggtgacatatatccgctgcaattattcaaaatag 36429557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 125; E-Value: 5e-64
Query Start/End: Original strand, 51 - 282
Target Start/End: Complemental strand, 36370993 - 36370762
Alignment:
51 aagtacatcatgcaccattaaattatcggccaattttaaggccactct-ttttattatatataacttacatgtccaattaaatttggggagtctcttcct 149  Q
    |||||||||||||||||||||||| | | || ||||| |||  | ||| |||| || | |||||||||||||||||||||||||||| || |||||||||    
36370993 aagtacatcatgcaccattaaattgttgaccgatttttaggtta-tctcttttcttttttataacttacatgtccaattaaatttggtgattctcttcct 36370895  T
150 gtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataactgaagacatcagattttgttgaatatcgtccttgcattgcat 249  Q
    || ||||||| ||||||||| | ||||||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||    
36370894 gtttcacaatatgtgtttctttggccagcaataatctctagtagtatgacaccataactgaagacatcagattttgttgaatatcgtccttccattgcat 36370795  T
250 attccggagacatatatccactgcaattataca 282  Q
    |||| || ||||||||| |||||||||||||||    
36370794 attctggtgacatatattcactgcaattataca 36370762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 8 - 280
Target Start/End: Complemental strand, 36390045 - 36389765
Alignment:
8 ccatagtgtccacacctacaaatgcataacataatgattaaata-agtacatcatgcaccattaaattatcggccaattttaaggccactcttt------ 100  Q
    |||||||||||||||||||||||| | |||| |||  ||||| | | |||||| | ||| |||||||| ||| ||||||||||||  ||| |||          
36390045 ccatagtgtccacacctacaaatgtacaacacaatctttaaaaataatacatcttacacgattaaattttcgaccaattttaaggatactttttctttat 36389946  T
101 -ttattatatataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagac 199  Q
     ||||| | || ||||||||||||||||||||||  ||||  |||||||||| ||| ||||||||||||| | ||||||||||||||| ||||||| |||    
36389945 tttattttttagaacttacatgtccaattaaattcagggatgctcttcctgtttcagaatgtgtgtttctttggccagcaataatctctagtagtatgac 36389846  T
200 cccataactgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattata 280  Q
     |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||    
36389845 accataactgaagacatcagattttgttgaatatcgtccttccattgcatattccggtgacatgtatccactgcaattata 36389765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 61
Target Start/End: Complemental strand, 36376800 - 36376747
Alignment:
8 ccatagtgtccacacctacaaatgcataacataatgattaaataagtacatcat 61  Q
    |||||||||||||||||||||||| | |||| |||  |||||||| ||||||||    
36376800 ccatagtgtccacacctacaaatgtacaacacaatctttaaataaatacatcat 36376747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 61
Target Start/End: Complemental strand, 36436310 - 36436257
Alignment:
8 ccatagtgtccacacctacaaatgcataacataatgattaaataagtacatcat 61  Q
    |||||||||||||||||||||||| | |||| |||  |||||||| ||||||||    
36436310 ccatagtgtccacacctacaaatgtacaacacaatctttaaataaatacatcat 36436257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 439 - 509
Target Start/End: Original strand, 15697353 - 15697423
Alignment:
439 ccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggat 509  Q
    |||||||| || ||||| ||||||||| || |||| || ||||| ||||||||||| ||||||||||||||    
15697353 ccaaaatctgatattttcggattcatttcatcatccagaagaacattgctggctttcagatctctatggat 15697423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 422 - 511
Target Start/End: Original strand, 15799843 - 15799932
Alignment:
422 caaatattctagccataccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggatta 511  Q
    ||||| |||| ||||  |||||||| || ||||| ||||||||| || |||| || ||||| ||||||||||| |||||||| |||||||    
15799843 caaatgttcttgccaatccaaaatctgatatttttggattcatttcatcatccagaagaacattgctggctttcagatctctgtggatta 15799932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 439 - 511
Target Start/End: Original strand, 15805392 - 15805464
Alignment:
439 ccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggatta 511  Q
    |||||||| || ||||| ||||||||| || |||| || ||||| ||||||||||| |||||||| |||||||    
15805392 ccaaaatctgatatttttggattcatttcatcatctagaagaacattgctggctttcagatctctgtggatta 15805464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 509
Target Start/End: Original strand, 15703715 - 15703802
Alignment:
422 caaatattctagccataccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggat 509  Q
    ||||| |||| ||||  |||||||| || ||||| ||||||||| || |||| || |||||||||| |||||| || |||||||||||    
15703715 caaattttcttgccaatccaaaatctgatatttttggattcatttcatcatctagaagaacgttgcaggctttaaggtctctatggat 15703802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 509
Target Start/End: Original strand, 15722546 - 15722633
Alignment:
422 caaatattctagccataccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggat 509  Q
    ||||| |||| |||| ||||||||| || ||||| ||||||||| ||   || || ||||||||||||||||| ||||||| ||||||    
15722546 caaattttcttgccaaaccaaaatctgatatttttggattcatttcactgtccagaagaacgttgctggctttcagatctcgatggat 15722633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 213 - 274
Target Start/End: Complemental strand, 19357703 - 19357642
Alignment:
213 acatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgca 274  Q
    |||||||| ||||||||| |   ||||| |||||||||||| |||||||| |||||||||||    
19357703 acatcagactttgttgaacaaattccttccattgcatattctggagacatgtatccactgca 19357642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 236 - 274
Target Start/End: Complemental strand, 20285147 - 20285109
Alignment:
236 tccttgcattgcatattccggagacatatatccactgca 274  Q
    |||||||||||||||||||||||||||||| ||||||||    
20285147 tccttgcattgcatattccggagacatatagccactgca 20285109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 235 - 274
Target Start/End: Complemental strand, 19939340 - 19939301
Alignment:
235 gtccttgcattgcatattccggagacatatatccactgca 274  Q
    ||||||||||||||||||| ||||||||||| ||||||||    
19939340 gtccttgcattgcatattctggagacatataaccactgca 19939301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 235 - 274
Target Start/End: Complemental strand, 19970479 - 19970440
Alignment:
235 gtccttgcattgcatattccggagacatatatccactgca 274  Q
    ||||||||||||||||||| ||||||||||| ||||||||    
19970479 gtccttgcattgcatattctggagacatataaccactgca 19970440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 236 - 274
Target Start/End: Complemental strand, 20294864 - 20294826
Alignment:
236 tccttgcattgcatattccggagacatatatccactgca 274  Q
    |||||||||||||||||| ||||||||||| ||||||||    
20294864 tccttgcattgcatattcaggagacatatagccactgca 20294826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 236 - 273
Target Start/End: Complemental strand, 20274013 - 20273976
Alignment:
236 tccttgcattgcatattccggagacatatatccactgc 273  Q
    |||||||||||||||||| ||||||||||| |||||||    
20274013 tccttgcattgcatattcaggagacatatagccactgc 20273976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 421 - 539
Target Start/End: Original strand, 2662470 - 2662588
Alignment:
421 ccaaatattctagccataccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggattattttcagcc 520  Q
    ||||| ||||| ||||| ||||| || || ||||| ||||||||| |  |||| |  ||||| ||||| ||||||||||||||||| |||||| | || |    
2662470 ccaaacattcttgccattccaaagtcagaaatttttggattcatttcgccatctaaaagaacattgcttgcttttagatctctatgaattattcttagtc 2662569  T
521 ttgaatcttgatgaagata 539  Q
    ||||||||  |||||||||    
2662570 ttgaatctctatgaagata 2662588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 236 - 274
Target Start/End: Original strand, 2716914 - 2716952
Alignment:
236 tccttgcattgcatattccggagacatatatccactgca 274  Q
    ||||| ||||||||||||||||||||| |||||||||||    
2716914 tccttccattgcatattccggagacatgtatccactgca 2716952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 2711998 - 2712035
Alignment:
237 ccttgcattgcatattccggagacatatatccactgca 274  Q
    |||| |||||||||||| ||||||||||||||||||||    
2711998 cctttcattgcatattctggagacatatatccactgca 2712035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 2723538 - 2723575
Alignment:
237 ccttgcattgcatattccggagacatatatccactgca 274  Q
    |||| ||||||||||||||||||||| |||||||||||    
2723538 ccttccattgcatattccggagacatgtatccactgca 2723575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 2745368 - 2745405
Alignment:
237 ccttgcattgcatattccggagacatatatccactgca 274  Q
    |||| ||||||||||||||||||||| |||||||||||    
2745368 ccttccattgcatattccggagacatgtatccactgca 2745405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 464
Target Start/End: Complemental strand, 13855213 - 13855176
Alignment:
427 attctagccataccaaaatccgagattttgggattcat 464  Q
    |||||||||||||||||||| || ||||||||||||||    
13855213 attctagccataccaaaatctgaaattttgggattcat 13855176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 235 - 271
Target Start/End: Original strand, 469810 - 469846
Alignment:
235 gtccttgcattgcatattccggagacatatatccact 271  Q
    |||| |||||||||||||||||||||||||| |||||    
469810 gtccgtgcattgcatattccggagacatataaccact 469846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98593 times since January 2019
Visitors: 2275