View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9101J-LTR4-TNT-insertion-8 (Length: 650)

Name: F9101J-LTR4-TNT-insertion-8
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9101J-LTR4-TNT-insertion-8
[»] chr4 (20 HSPs)
chr4 (8-640)||(36419242-36419874)
chr4 (368-622)||(36429253-36429507)
chr4 (357-622)||(36435706-36435971)
chr4 (370-618)||(36376212-36376460)
chr4 (368-622)||(36407098-36407352)
chr4 (370-622)||(36399641-36399893)
chr4 (8-318)||(36407379-36407694)
chr4 (8-318)||(36412502-36412817)
chr4 (84-305)||(36399937-36400158)
chr4 (370-622)||(36370416-36370688)
chr4 (357-618)||(36389456-36389718)
chr4 (107-288)||(36436019-36436200)
chr4 (107-288)||(36376521-36376702)
chr4 (109-318)||(36401218-36401427)
chr4 (368-530)||(36412313-36412475)
chr4 (111-288)||(36429557-36429734)
chr4 (51-282)||(36370762-36370993)
chr4 (8-280)||(36389765-36390045)
chr4 (8-61)||(36376747-36376800)
chr4 (8-61)||(36436257-36436310)
[»] chr8 (6 HSPs)
chr8 (439-509)||(15697353-15697423)
chr8 (422-511)||(15799843-15799932)
chr8 (439-511)||(15805392-15805464)
chr8 (422-509)||(15703715-15703802)
chr8 (422-509)||(15722546-15722633)
chr8 (213-274)||(19357642-19357703)
[»] chr7 (5 HSPs)
chr7 (236-274)||(20285109-20285147)
chr7 (235-274)||(19939301-19939340)
chr7 (235-274)||(19970440-19970479)
chr7 (236-274)||(20294826-20294864)
chr7 (236-273)||(20273976-20274013)
[»] chr2 (5 HSPs)
chr2 (421-539)||(2662470-2662588)
chr2 (236-274)||(2716914-2716952)
chr2 (237-274)||(2711998-2712035)
chr2 (237-274)||(2723538-2723575)
chr2 (237-274)||(2745368-2745405)
[»] chr3 (1 HSPs)
chr3 (427-464)||(13855176-13855213)
[»] chr5 (1 HSPs)
chr5 (235-271)||(469810-469846)

Alignment Details
Target: chr4 (Bit Score: 633; Significance: 0; HSPs: 20)
Name: chr4

Target: chr4; HSP #1
Raw Score: 633; E-Value: 0
Query Start/End: Original strand, 8 - 640
Target Start/End: Complemental strand, 36419874 - 36419242
8 ccatagtgtccacacctacaaatgcataacataatgattaaataagtacatcatgcaccattaaattatcggccaattttaaggccactctttttattat 107  Q
36419874 ccatagtgtccacacctacaaatgcataacataatgattaaataagtacatcatgcaccattaaattatcggccaattttaaggccactctttttattat 36419775  T
108 atataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataac 207  Q
36419774 atataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataac 36419675  T
208 tgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatagctatagcatcataaaaata 307  Q
36419674 tgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatagctatagcatcataaaaata 36419575  T
308 cagatcaatctctaaagccactacaactttacaaaatagttggagtatcataagggcatcacacatactatgttccaacaactctttttgttctagcttg 407  Q
36419574 cagatcaatctctaaagccactacaactttacaaaatagttggagtatcataagggcatcacacatactatgttccaacaactctttttgttctagcttg 36419475  T
408 aatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatgg 507  Q
36419474 aatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatgg 36419375  T
508 attattttcagccttgaatcttgatgaagatataatacacctcgagcaatcccacaaataatttcaaaacgcgtaacccaatccaatgatgacctttggt 607  Q
36419374 attattttcagccttgaatcttgatgaagatataatacacctcgagcaatcccacaaataatttcaaaacgcgtaacccaatccaatgatgacctttggt 36419275  T
608 tttgatctgagttgagcatattagcaatcatta 640  Q
36419274 tttgatctgagttgagcatattagcaatcatta 36419242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 368 - 622
Target Start/End: Complemental strand, 36429507 - 36429253
368 acacatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattac 467  Q
    |||| ||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |    
36429507 acacctactatgttccgaccactctttttgttcttgcttgaatttcatcttctccaaatattctagccataccaaaatctgagattttgggattcattgc 36429408  T
468 agcatcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatacacctcgagcaatcccacaaata 567  Q
    |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
36429407 agcatcgaggagaacgttgctggcttttagatctctatgaattattttcagccttgaatcttgatgaagatataaaacacctcgagcaatcccacaaata 36429308  T
568 atttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgagttga 622  Q
    |||||||||||| | |||||||||||||| |||||||||||||||||||||||||    
36429307 atttcaaaacgctttacccaatccaatgacgacctttggttttgatctgagttga 36429253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 357 - 622
Target Start/End: Complemental strand, 36435971 - 36435706
357 ataagggcatcacacatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttg 456  Q
    ||||||| || | ||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||    
36435971 ataagggtatgaaacatactatgttccaaccactctttttgttcttgcttgtatttcatcttctccaaatattctagccataccaaaatctgagattttg 36435872  T
457 ggattcattacagcatcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatacacctcgagcaa 556  Q
    ||||||||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||    
36435871 ggattcattgcagcatcaaggagaacattgctggcttttagatctctatgaattattttcagccttgaatcttgatgaagatataaaacacctcgagcaa 36435772  T
557 tcccacaaataatttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgagttga 622  Q
    | ||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||    
36435771 tgccacaaataatttcaaaacgcttaccccaatccaataatgacctttggttttgatctgagttga 36435706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 370 - 618
Target Start/End: Complemental strand, 36376460 - 36376212
370 acatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattacag 469  Q
    ||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||    
36376460 acatactatgttccaaccactctttttgttcttgcttgtatttcatcttctccaaatattctagccataccaaaatctgagattttgggattcattgcag 36376361  T
470 catcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatacacctcgagcaatcccacaaataat 569  Q
    |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
36376360 catcgaggagaacgttgctggcttttagatctctatgaattattttcagccttgaatcttgatgaagatataaaacacctcgagcaatcccacaaataat 36376261  T
570 ttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgag 618  Q
    |||||||||| |  |||||||||||||||||||||||||||||||||||    
36376260 ttcaaaacgctttccccaatccaatgatgacctttggttttgatctgag 36376212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 368 - 622
Target Start/End: Complemental strand, 36407352 - 36407098
368 acacatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattac 467  Q
    |||||||||||||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |    
36407352 acacatactatgttccgaccactctttttgttcttgcttggatttcatcttctccaaatattctagccataccaaaatctgagattttgggattcattgc 36407253  T
468 agcatcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatacacctcgagcaatcccacaaata 567  Q
    ||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||     
36407252 agcgtcaaggagaacattgctggcttttagatctctatgaattattttcagccttgaatcttggtgaagatataaaacacctcgagcaatcccacaaatg 36407153  T
568 atttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgagttga 622  Q
    |||||||||||| | ||||||||||||||||||||||||||||||||||||||||    
36407152 atttcaaaacgctttacccaatccaatgatgacctttggttttgatctgagttga 36407098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 370 - 622
Target Start/End: Complemental strand, 36399893 - 36399641
370 acatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattacag 469  Q
    |||||||||||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||    
36399893 acatactatgttccgaccactctttttgttcttgcttggatttcatcttctccaaatattctagccataccgaaatctgagattttgggattcatttcag 36399794  T
470 catcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatacacctcgagcaatcccacaaataat 569  Q
    ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||    
36399793 catcaaggagaacattgctggcttttagatctctatgaattattttcagccttgaatcttggtgaagatataaaacacctcgagcaatgccacaaataat 36399694  T
570 ttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgagttga 622  Q
    |||||||||| || |||||||||||||||||||||||||||||||||||||||    
36399693 ttcaaaacgcttaccccaatccaatgatgacctttggttttgatctgagttga 36399641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 8 - 318
Target Start/End: Complemental strand, 36407694 - 36407379
8 ccatagtgtccacacctacaaatgcataacataatgattaaataagta---cat--catgcaccattaaattatcggccaattttaaggccactcttttt 102  Q
    |||||||||||||||||| ||||||| |||| |||  |||||||| ||   |||  |||||| ||||| ||| | ||||||||||||||| |||||||||    
36407694 ccatagtgtccacacctataaatgcacaacacaatttttaaataaatatgtcatgtcatgcatcattagattgttggccaattttaaggctactcttttt 36407595  T
103 attatatataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagacccc 202  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||  | ||||||||||||||||||||||||||||||||||||||||||||||||||    
36407594 attatatgtaacttacatgtccaattaaatttggggagtctcttccaatttcacaatgtgtgtttctcttgccagcaataatctccagtagtaagacccc 36407495  T
203 ataactgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatagctatagcatcataa 302  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||| ||||||| | || || |||||||    
36407494 ataactgaagacatcagattttgttgaatatcgtccttccattgcatattctggtgacatatatccactgcaattaaacaaaatggttagagtatcataa 36407395  T
303 aaatacagatcaatct 318  Q
    ||||||| ||| ||||    
36407394 aaatacatatccatct 36407379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 8 - 318
Target Start/End: Complemental strand, 36412817 - 36412502
8 ccatagtgtccacacctacaaatgcataacataatgattaaataagta---cat--catgcaccattaaattatcggccaattttaaggccactcttttt 102  Q
    |||||||||||||||||| ||||||| |||| |||  |||||||| ||   |||  |||||| ||||| ||| | ||||||||||||||| |||||||||    
36412817 ccatagtgtccacacctataaatgcacaacacaatttttaaataaatatgtcatgtcatgcatcattagattgttggccaattttaaggctactcttttt 36412718  T
103 attatatataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagacccc 202  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||  | ||||||||||||||||||||||||||||||||||||||||||||||||||    
36412717 attatatgtaacttacatgtccaattaaatttggggagtctcttccaatttcacaatgtgtgtttctcttgccagcaataatctccagtagtaagacccc 36412618  T
203 ataactgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatagctatagcatcataa 302  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||| ||||||| | || || |||||||    
36412617 ataactgaagacatcagattttgttgaatatcgtccttccattgcatattctggtgacatatatccactgcaattaaacaaaatggttagagtatcataa 36412518  T
303 aaatacagatcaatct 318  Q
    ||||||| ||| ||||    
36412517 aaatacatatccatct 36412502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 166; E-Value: 2e-88
Query Start/End: Original strand, 84 - 305
Target Start/End: Complemental strand, 36400158 - 36399937
84 ttttaaggccactctttttattatatataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataa 183  Q
    ||||||||| |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||  | |||||||||||||||||||||||||||||||    
36400158 ttttaaggctactctttttaatatatttaacttacatgtccaattaaatttggggagtctcttccaatttcacaatgtgtgtttctcttgccagcaataa 36400059  T
184 tctccagtagtaagaccccataactgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaa 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||| ||||||||||||||||||||    
36400058 tctccagtagtaagaccccataactgaagacatcagattttgttgaatatcgtccttccattgcatattcgggtgacatgtatccactgcaattatacaa 36399959  T
284 aatagctatagcatcataaaaa 305  Q
    ||| | || || ||||||||||    
36399958 aatggttagagtatcataaaaa 36399937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 370 - 622
Target Start/End: Complemental strand, 36370688 - 36370416
370 acatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattacag 469  Q
    |||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||    
36370688 acatactatgttccgaccactctttttgttcttgcttgaatttcatcttctccaaatattctagccataccaaaatctgagattttgggattcatttcag 36370589  T
470 catcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatac--------------------acct 549  Q
    ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||                     |||    
36370588 catcaaggagaacattgctggcttttagatctctatgaattattttcagccttgaatcttggtgaagatataaaacgcttaacccaaataatttcagcct 36370489  T
550 cgagcaatcccacaaataatttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgagttga 622  Q
    ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||    
36370488 cgagcaatcacacaaataatttcaaaacgcttaacccaatccaatgatgacctttgattttgatctgagttga 36370416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 148; E-Value: 9e-78
Query Start/End: Original strand, 357 - 618
Target Start/End: Complemental strand, 36389718 - 36389456
357 ataagggcatcacacatactatgttccaacaactctttttgttctagcttgaatttcatcttc---tccaaatattctagccataccaaaatccgagatt 453  Q
    ||||||| || | ||||||||||||||||| |||||||||||| | ||||| |||||||| ||   ||||||||||||||||||||||||||| ||||||    
36389718 ataagggtatgagacatactatgttccaaccactctttttgttattgcttggatttcatcatcgtctccaaatattctagccataccaaaatctgagatt 36389619  T
454 ttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttgatgaagatataatacacctcgag 553  Q
    || || |||||| |||| ||||||||||| |||||||||||||| |||||||| || |||||||||||||||||||||||||||||||| || |||||||    
36389618 ttagggttcattgcagcgtcaaggagaacattgctggcttttaggtctctatgaatgattttcagccttgaatcttgatgaagatataaaacgcctcgag 36389519  T
554 caatcccacaaataatttcaaaacgcgtaacccaatccaatgatgacctttggttttgatctgag 618  Q
    |||||||||  ||||||||||||||  |  |||||||||||||||||||||||||||||||||||    
36389518 caatcccac--ataatttcaaaacgtttgccccaatccaatgatgacctttggttttgatctgag 36389456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 107 - 288
Target Start/End: Complemental strand, 36436200 - 36436019
107 tatataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataa 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||||||| || ||| ||    
36436200 tatataacttacatgtccaattaaatttggggagtctcttcctgtttcacaatgtgtgtttctttggccagcaataatctccagtagtaaaacaccaaaa 36436101  T
207 ctgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatag 288  Q
    ||||||||||| ||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||    
36436100 ctgaagacatccgatttagttgaatatcgtccttccattgcatattccggtgacatatatccactgcaattatacaaaatag 36436019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 138; E-Value: 8e-72
Query Start/End: Original strand, 107 - 288
Target Start/End: Complemental strand, 36376702 - 36376521
107 tatataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataa 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | ||| |||||||||||||||||||| || ||| ||    
36376702 tatataacttacatgtccaattaaatttggggagtctcttcctgtttcacaatgtgtgtttctttggccggcaataatctccagtagtaaaacaccaaaa 36376603  T
207 ctgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatag 288  Q
    ||||||||||| ||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||    
36376602 ctgaagacatccgatttagttgaatatcgtccttccattgcatattccggtgacatatatccactgcaattatacaaaatag 36376521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 130; E-Value: 5e-67
Query Start/End: Original strand, 109 - 318
Target Start/End: Complemental strand, 36401427 - 36401218
109 tataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataact 208  Q
    |||||||||||||||||||||||||||||||  |||||||||| ||||||||||||||||| |  |||||||||||||| || |||||||||||||||||    
36401427 tataacttacatgtccaattaaatttggggaagctcttcctgtttcacaatgtgtgtttctttgaccagcaataatctctagcagtaagaccccataact 36401328  T
209 gaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatagctatagcatcataaaaatac 308  Q
     |||||||||||||| |||||||||||||||| |||||||||||| || ||||||||||||||||||||| ||||||| | || || |||||||||||||    
36401327 aaagacatcagatttcgttgaatatcgtccttccattgcatattctggtgacatatatccactgcaattaaacaaaatggttagagtatcataaaaatac 36401228  T
309 agatcaatct 318  Q
    | ||| ||||    
36401227 atatccatct 36401218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 368 - 530
Target Start/End: Complemental strand, 36412475 - 36412313
368 acacatactatgttccaacaactctttttgttctagcttgaatttcatcttctccaaatattctagccataccaaaatccgagattttgggattcattac 467  Q
    |||||||||||||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |    
36412475 acacatactatgttccgaccactctttttgttcttgcttggatttcatcttctccaaatattctagccataccaaaatctgagattttgggattcattgc 36412376  T
468 agcatcaaggagaacgttgctggcttttagatctctatggattattttcagccttgaatcttg 530  Q
    ||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||    
36412375 agcgtcaaggagaacattgctggcttttagatctctatgaattattttcagccttgaatcttg 36412313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 111 - 288
Target Start/End: Complemental strand, 36429734 - 36429557
111 taacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataactga 210  Q
    ||||||||||||||||||||||||||||| ||||||||| | ||||||||||||||||| | |||||||||| |||||||||||| ||||||||||||||    
36429734 taacttacatgtccaattaaatttggggattctcttcctttttcacaatgtgtgtttctttggccagcaatagtctccagtagtatgaccccataactga 36429635  T
211 agacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattatacaaaatag 288  Q
    ||||||||||||| |||||||||||||||| |||||||||||| || ||||||||||| |||||||||| ||||||||    
36429634 agacatcagatttcgttgaatatcgtccttccattgcatattctggtgacatatatccgctgcaattattcaaaatag 36429557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 125; E-Value: 5e-64
Query Start/End: Original strand, 51 - 282
Target Start/End: Complemental strand, 36370993 - 36370762
51 aagtacatcatgcaccattaaattatcggccaattttaaggccactct-ttttattatatataacttacatgtccaattaaatttggggagtctcttcct 149  Q
    |||||||||||||||||||||||| | | || ||||| |||  | ||| |||| || | |||||||||||||||||||||||||||| || |||||||||    
36370993 aagtacatcatgcaccattaaattgttgaccgatttttaggtta-tctcttttcttttttataacttacatgtccaattaaatttggtgattctcttcct 36370895  T
150 gtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagaccccataactgaagacatcagattttgttgaatatcgtccttgcattgcat 249  Q
    || ||||||| ||||||||| | ||||||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||    
36370894 gtttcacaatatgtgtttctttggccagcaataatctctagtagtatgacaccataactgaagacatcagattttgttgaatatcgtccttccattgcat 36370795  T
250 attccggagacatatatccactgcaattataca 282  Q
    |||| || ||||||||| |||||||||||||||    
36370794 attctggtgacatatattcactgcaattataca 36370762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 8 - 280
Target Start/End: Complemental strand, 36390045 - 36389765
8 ccatagtgtccacacctacaaatgcataacataatgattaaata-agtacatcatgcaccattaaattatcggccaattttaaggccactcttt------ 100  Q
    |||||||||||||||||||||||| | |||| |||  ||||| | | |||||| | ||| |||||||| ||| ||||||||||||  ||| |||          
36390045 ccatagtgtccacacctacaaatgtacaacacaatctttaaaaataatacatcttacacgattaaattttcgaccaattttaaggatactttttctttat 36389946  T
101 -ttattatatataacttacatgtccaattaaatttggggagtctcttcctgtctcacaatgtgtgtttctcttgccagcaataatctccagtagtaagac 199  Q
     ||||| | || ||||||||||||||||||||||  ||||  |||||||||| ||| ||||||||||||| | ||||||||||||||| ||||||| |||    
36389945 tttattttttagaacttacatgtccaattaaattcagggatgctcttcctgtttcagaatgtgtgtttctttggccagcaataatctctagtagtatgac 36389846  T
200 cccataactgaagacatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgcaattata 280  Q
     |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||    
36389845 accataactgaagacatcagattttgttgaatatcgtccttccattgcatattccggtgacatgtatccactgcaattata 36389765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 61
Target Start/End: Complemental strand, 36376800 - 36376747
8 ccatagtgtccacacctacaaatgcataacataatgattaaataagtacatcat 61  Q
    |||||||||||||||||||||||| | |||| |||  |||||||| ||||||||    
36376800 ccatagtgtccacacctacaaatgtacaacacaatctttaaataaatacatcat 36376747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 61
Target Start/End: Complemental strand, 36436310 - 36436257
8 ccatagtgtccacacctacaaatgcataacataatgattaaataagtacatcat 61  Q
    |||||||||||||||||||||||| | |||| |||  |||||||| ||||||||    
36436310 ccatagtgtccacacctacaaatgtacaacacaatctttaaataaatacatcat 36436257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 6)
Name: chr8

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 439 - 509
Target Start/End: Original strand, 15697353 - 15697423
439 ccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggat 509  Q
    |||||||| || ||||| ||||||||| || |||| || ||||| ||||||||||| ||||||||||||||    
15697353 ccaaaatctgatattttcggattcatttcatcatccagaagaacattgctggctttcagatctctatggat 15697423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 422 - 511
Target Start/End: Original strand, 15799843 - 15799932
422 caaatattctagccataccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggatta 511  Q
    ||||| |||| ||||  |||||||| || ||||| ||||||||| || |||| || ||||| ||||||||||| |||||||| |||||||    
15799843 caaatgttcttgccaatccaaaatctgatatttttggattcatttcatcatccagaagaacattgctggctttcagatctctgtggatta 15799932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 439 - 511
Target Start/End: Original strand, 15805392 - 15805464
439 ccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggatta 511  Q
    |||||||| || ||||| ||||||||| || |||| || ||||| ||||||||||| |||||||| |||||||    
15805392 ccaaaatctgatatttttggattcatttcatcatctagaagaacattgctggctttcagatctctgtggatta 15805464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 509
Target Start/End: Original strand, 15703715 - 15703802
422 caaatattctagccataccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggat 509  Q
    ||||| |||| ||||  |||||||| || ||||| ||||||||| || |||| || |||||||||| |||||| || |||||||||||    
15703715 caaattttcttgccaatccaaaatctgatatttttggattcatttcatcatctagaagaacgttgcaggctttaaggtctctatggat 15703802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 509
Target Start/End: Original strand, 15722546 - 15722633
422 caaatattctagccataccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggat 509  Q
    ||||| |||| |||| ||||||||| || ||||| ||||||||| ||   || || ||||||||||||||||| ||||||| ||||||    
15722546 caaattttcttgccaaaccaaaatctgatatttttggattcatttcactgtccagaagaacgttgctggctttcagatctcgatggat 15722633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 213 - 274
Target Start/End: Complemental strand, 19357703 - 19357642
213 acatcagattttgttgaatatcgtccttgcattgcatattccggagacatatatccactgca 274  Q
    |||||||| ||||||||| |   ||||| |||||||||||| |||||||| |||||||||||    
19357703 acatcagactttgttgaacaaattccttccattgcatattctggagacatgtatccactgca 19357642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 5)
Name: chr7

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 236 - 274
Target Start/End: Complemental strand, 20285147 - 20285109
236 tccttgcattgcatattccggagacatatatccactgca 274  Q
    |||||||||||||||||||||||||||||| ||||||||    
20285147 tccttgcattgcatattccggagacatatagccactgca 20285109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 235 - 274
Target Start/End: Complemental strand, 19939340 - 19939301
235 gtccttgcattgcatattccggagacatatatccactgca 274  Q
    ||||||||||||||||||| ||||||||||| ||||||||    
19939340 gtccttgcattgcatattctggagacatataaccactgca 19939301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 235 - 274
Target Start/End: Complemental strand, 19970479 - 19970440
235 gtccttgcattgcatattccggagacatatatccactgca 274  Q
    ||||||||||||||||||| ||||||||||| ||||||||    
19970479 gtccttgcattgcatattctggagacatataaccactgca 19970440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 236 - 274
Target Start/End: Complemental strand, 20294864 - 20294826
236 tccttgcattgcatattccggagacatatatccactgca 274  Q
    |||||||||||||||||| ||||||||||| ||||||||    
20294864 tccttgcattgcatattcaggagacatatagccactgca 20294826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 236 - 273
Target Start/End: Complemental strand, 20274013 - 20273976
236 tccttgcattgcatattccggagacatatatccactgc 273  Q
    |||||||||||||||||| ||||||||||| |||||||    
20274013 tccttgcattgcatattcaggagacatatagccactgc 20273976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 5)
Name: chr2

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 421 - 539
Target Start/End: Original strand, 2662470 - 2662588
421 ccaaatattctagccataccaaaatccgagattttgggattcattacagcatcaaggagaacgttgctggcttttagatctctatggattattttcagcc 520  Q
    ||||| ||||| ||||| ||||| || || ||||| ||||||||| |  |||| |  ||||| ||||| ||||||||||||||||| |||||| | || |    
2662470 ccaaacattcttgccattccaaagtcagaaatttttggattcatttcgccatctaaaagaacattgcttgcttttagatctctatgaattattcttagtc 2662569  T
521 ttgaatcttgatgaagata 539  Q
    ||||||||  |||||||||    
2662570 ttgaatctctatgaagata 2662588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 236 - 274
Target Start/End: Original strand, 2716914 - 2716952
236 tccttgcattgcatattccggagacatatatccactgca 274  Q
    ||||| ||||||||||||||||||||| |||||||||||    
2716914 tccttccattgcatattccggagacatgtatccactgca 2716952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 2711998 - 2712035
237 ccttgcattgcatattccggagacatatatccactgca 274  Q
    |||| |||||||||||| ||||||||||||||||||||    
2711998 cctttcattgcatattctggagacatatatccactgca 2712035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 2723538 - 2723575
237 ccttgcattgcatattccggagacatatatccactgca 274  Q
    |||| ||||||||||||||||||||| |||||||||||    
2723538 ccttccattgcatattccggagacatgtatccactgca 2723575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 237 - 274
Target Start/End: Original strand, 2745368 - 2745405
237 ccttgcattgcatattccggagacatatatccactgca 274  Q
    |||| ||||||||||||||||||||| |||||||||||    
2745368 ccttccattgcatattccggagacatgtatccactgca 2745405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 464
Target Start/End: Complemental strand, 13855213 - 13855176
427 attctagccataccaaaatccgagattttgggattcat 464  Q
    |||||||||||||||||||| || ||||||||||||||    
13855213 attctagccataccaaaatctgaaattttgggattcat 13855176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 235 - 271
Target Start/End: Original strand, 469810 - 469846
235 gtccttgcattgcatattccggagacatatatccact 271  Q
    |||| |||||||||||||||||||||||||| |||||    
469810 gtccgtgcattgcatattccggagacatataaccact 469846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC