View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9101J-LTR4-TNT-insertion-9 (Length: 715)

Name: F9101J-LTR4-TNT-insertion-9
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9101J-LTR4-TNT-insertion-9
F9101J-LTR4-TNT-insertion-9
[»] chr1 (1 HSPs)
chr1 (10-705)||(26217093-26217788)


Alignment Details
Target: chr1 (Bit Score: 688; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 688; E-Value: 0
Query Start/End: Original strand, 10 - 705
Target Start/End: Complemental strand, 26217788 - 26217093
Alignment:
10 gtacatatttagactccgtgaatttctcctttctaatcagggctgataaaccttcatcataaagaaacccataagaaagggtccccttgttgaagacctc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26217788 gtacatatttagactccgtgaatttctcctttctaatcagggctgataaaccttcatcataaagaaacccataagaaagggtccccttgttgaagacctc 26217689  T
110 ttgcaagtatgacagggtccactacacttctattaacaatgacggagtaatccataattcaaacacacaacataatcgaaatccaacctatcataggatt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26217688 ttgcaagtatgacagggtccactacacttctattaacaatgacggagtaatccataattcaaacacacaacataatcgaaatccaacctatcataggatt 26217589  T
210 tactaatataaagtctatgagctacattaccttgattaactttcaccttaggtttcacacgatgaacaatttcaatggttgtcattgcattatcgagaat 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26217588 tactaatataaagtctatgagctacattaccttgattaactttcaccttaggtttcacacgatgaacaatttcaatggttgtcattgcattatcgagaat 26217489  T
310 agagtaacttgacacaaaagccgattgatttttgtatatacacttatcaagtacactttcaacatgttggctaatactttaaccacaactttatagagca 409  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26217488 agagtaacttgacacaaaagctgattgatttttgtatatacacttatcaagtacactttcaacatgttggctaatactttaaccacaactttatagagca 26217389  T
410 cattacataaagctatagatgaataaacctctcccatagggattagatcaatgtttgttgagtttgtaattaggctaggaggaaagataacagagacctt 509  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26217388 cattacataaagctatagatgaataaacctctcctatagggattagatcaatgtttgttgagtttgtaattaggctaggaggaaagataacagagacctt 26217289  T
510 caaagtgcaacccgcagtaaatatatgatgaccacaatttttctaattttttgttaaataaaaatcagggttatagccataacgtcctcgtcattatcaa 609  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26217288 caaagtgcaacccgcagtaaatatatgatgaccacaatttttctaattttttgttaaataaaaatcagggttatagccataacgtcctcgtcattatcaa 26217189  T
610 ctttcatagagaagatggtttccttgaattcttcaaataggaaagcggcaaatagaaactcattatccatactagtgaatagtgttagatggatta 705  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26217188 ctttcatagagaagatggtttccttgaattcttcaaataggaaagcggcaaatagaaactcattatccatactagtgaatagtgttagatggatta 26217093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105661 times since January 2019
Visitors: 2328