View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9105J-LTR4-TNT-insertion-1 (Length: 294)

Name: F9105J-LTR4-TNT-insertion-1
Description: F9105J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9105J-LTR4-TNT-insertion-1
[»] chr4 (1 HSPs)
chr4 (8-284)||(49234701-49234977)

Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 8 - 284
Target Start/End: Original strand, 49234701 - 49234977
8 gaaggaatgaccgtattagatgctcattcttaactgccagaatatgtatagtttatgagttactcaaacttttatgggtgaatatatatctttttactta 107  Q
49234701 gaaggaatgaccgtattagatgctcattcttaactgccagaatatgtatagtttatgagttactcaaacttttatgggtgaatatatatctttttactta 49234800  T
108 gtatcaatgtgtagttagtttgagtgagagtaaacaattgtgtgctgttcatttatttaatatcaaactagatagatatctatgaaagatggacagccca 207  Q
49234801 gtatcaatgtgtagttagtttgagtgagagtaaacaattgtgtgctgttcatttatttaatatcaaactagatagatatctatgaaagatggacagccca 49234900  T
208 actgatttaaactaagggattaggagttgatggttctgcatttaaatccgaagaaagaaaaaagaaactaattatta 284  Q
49234901 actgatttaaactaagggattaggagttgatggttctgcatttaaatccgaagaaagaaaaaagaaactaattatta 49234977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 105342 times since January 2019
Visitors: 2324