View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9105J-LTR4-TNT-insertion-1 (Length: 294)

Name: F9105J-LTR4-TNT-insertion-1
Description: F9105J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9105J-LTR4-TNT-insertion-1
F9105J-LTR4-TNT-insertion-1
[»] chr4 (1 HSPs)
chr4 (8-284)||(49234701-49234977)


Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 8 - 284
Target Start/End: Original strand, 49234701 - 49234977
Alignment:
8 gaaggaatgaccgtattagatgctcattcttaactgccagaatatgtatagtttatgagttactcaaacttttatgggtgaatatatatctttttactta 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49234701 gaaggaatgaccgtattagatgctcattcttaactgccagaatatgtatagtttatgagttactcaaacttttatgggtgaatatatatctttttactta 49234800  T
108 gtatcaatgtgtagttagtttgagtgagagtaaacaattgtgtgctgttcatttatttaatatcaaactagatagatatctatgaaagatggacagccca 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49234801 gtatcaatgtgtagttagtttgagtgagagtaaacaattgtgtgctgttcatttatttaatatcaaactagatagatatctatgaaagatggacagccca 49234900  T
208 actgatttaaactaagggattaggagttgatggttctgcatttaaatccgaagaaagaaaaaagaaactaattatta 284  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49234901 actgatttaaactaagggattaggagttgatggttctgcatttaaatccgaagaaagaaaaaagaaactaattatta 49234977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC