View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9105J-LTR4-TNT-insertion-2 (Length: 371)

Name: F9105J-LTR4-TNT-insertion-2
Description: F9105J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9105J-LTR4-TNT-insertion-2
F9105J-LTR4-TNT-insertion-2
[»] chr3 (3 HSPs)
chr3 (7-363)||(28750112-28750468)
chr3 (120-351)||(28740453-28740684)
chr3 (160-312)||(51122623-51122775)
[»] chr5 (1 HSPs)
chr5 (121-363)||(39942277-39942518)
[»] chr2 (3 HSPs)
chr2 (159-351)||(34947074-34947266)
chr2 (159-273)||(30013090-30013204)
chr2 (159-273)||(30072815-30072929)


Alignment Details
Target: chr3 (Bit Score: 353; Significance: 0; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 7 - 363
Target Start/End: Original strand, 28750112 - 28750468
Alignment:
7 aacattaaattaaaactaaatgtttggactcattctcatcttatagttcattcatagaaaagatatatgtcatgcaatgcaaacaaatatttcaatgcaa 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28750112 aacattaaattaaaactaaatgtttggactcattctcatcttatagttcattcatagaaaagatatatgtcatgcaatgcaaacaaatatttcaatgcaa 28750211  T
107 aattcaaataattaagttagtgtacctttcggagtggaagcactgaaaagagaccaagaaagctaacaacaaatagaaatgcaatcatccatcctaaacc 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28750212 aattcaaataattaagttagtgtacctttcggagtggaagcactgaaaagagaccaagaaagctaacaacaaatagaaatgcaatcatccatcctaaacc 28750311  T
207 aagactcttaacgtcattggcactgtcaaattctggaatttgttttgcaatagttggactcattccaaacaagtagctaccaaacccacctacacaaaca 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28750312 aagactcttaacgtcattggcactgtcaaattctggaatttgttttgcaatagttggactcattccaaacaagtagctaccaaacccacctacacaaaca 28750411  T
307 aatcaagtaaaatacttgtcaaaaacaaacaagatcattgtatcatcactgcaatta 363  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
28750412 aatcaagtaaaatatttgtcaaaaacaaacaagatcattgtatcatcactgcaatta 28750468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 120 - 351
Target Start/End: Original strand, 28740453 - 28740684
Alignment:
120 aagttagtgtacctttcggagtggaagcactgaaaagagaccaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacg 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||     
28740453 aagttagtgtacctttcggagtggaagcactgaaaagagaccaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagaatcttaaca 28740552  T
220 tcattggcactgtcaaattctggaatttgttttgcaatagttggactcattccaaacaagtagctaccaaacccacctacacaaacaaatcaagtaaaat 319  Q
    ||||||| ||  ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| | |||||||||||||||    
28740553 tcattggaaccatcaaattctggaatttgttttgcaatagttggagtcattccaaacaagtagctaccaaatccacctacacgagcaaatcaagtaaaat 28740652  T
320 acttgtcaaaaacaaacaagatcattgtatca 351  Q
    | ||||| | |||||| ||| |||||||||||    
28740653 atttgtcgacaacaaataaggtcattgtatca 28740684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 160 - 312
Target Start/End: Complemental strand, 51122775 - 51122623
Alignment:
160 ccaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacgtcattggcactgtcaaattctggaatttgttttgcaatag 259  Q
    |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||| || ||||||||||||||||||||||||||||||    
51122775 ccaagaaagctaacaacaaataaaaatgcaatcatccatcctaaatcaagactcttaacatcattgacagtgtcaaattctggaatttgttttgcaatag 51122676  T
260 ttggactcattccaaacaagtagctaccaaacccacctacacaaacaaatcaa 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||    
51122675 ttggactcattccaaacaagtagctaccaaacccacctacacaaaaaaatcaa 51122623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 171; Significance: 9e-92; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 121 - 363
Target Start/End: Complemental strand, 39942518 - 39942277
Alignment:
121 agttagtgtacctttcggagtggaagcactgaaaagagaccaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacgt 220  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |    
39942518 agttagtgtacctttcggagtggaaccactgaaaagagaccaagaaagctgacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacat 39942419  T
221 cattggcactgtcaaattctggaatttgttttgcaatagttggactcattccaaacaagtagctaccaaacccacctacacaaacaaatcaagtaaaata 320  Q
    |||||||| || ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |    
39942418 cattggcagtgccagcttctggaatttgttttgcaatagttggactcattccaaacaagtagctaccaaacccacctacacaagcaaat-aagtaaaaga 39942320  T
321 cttgtcaaaaacaaacaagatcattgtatcatcactgcaatta 363  Q
     ||||||| ||||||  || |||||||||||  ||||||||||    
39942319 tttgtcaacaacaaatgaggtcattgtatcagaactgcaatta 39942277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 141; Significance: 7e-74; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 159 - 351
Target Start/End: Original strand, 34947074 - 34947266
Alignment:
159 accaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacgtcattggcactgtcaaattctggaatttgttttgcaata 258  Q
    |||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| ||||| ||| |||||||||||| ||||||||||||||||    
34947074 accaagaaagctaacaacaaatagaaatccaatcatccatcctaaacaaagactcttaacatcattagcagtgtcaaattctgaaatttgttttgcaata 34947173  T
259 gttggactcattccaaacaagtagctaccaaacccacctacacaaacaaatcaagtaaaatacttgtcaaaaacaaacaagatcattgtatca 351  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||||| |||||| ||| ||||| |||||    
34947174 gttggactcattccaaacaagtagctaccaaacccacctacacaaaaaaatcaagtaaaagacatgtcaacaacaaataaggtcattatatca 34947266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 159 - 273
Target Start/End: Complemental strand, 30013204 - 30013090
Alignment:
159 accaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacgtcattggcactgtcaaattctggaatttgttttgcaata 258  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||    
30013204 accaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagattcttaacatcattggcagtgtcaaattctggaatttgttttgcaata 30013105  T
259 gttggactcattcca 273  Q
    |||||||||||||||    
30013104 gttggactcattcca 30013090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 159 - 273
Target Start/End: Complemental strand, 30072929 - 30072815
Alignment:
159 accaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacgtcattggcactgtcaaattctggaatttgttttgcaata 258  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||    
30072929 accaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagattcttaacatcattggcagtgtcaaattctggaatttgttttgcaata 30072830  T
259 gttggactcattcca 273  Q
    |||||||||||||||    
30072829 gttggactcattcca 30072815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 77726 times since January 2019
Visitors: 2276