View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9105J-LTR4-TNT-insertion-2 (Length: 371)

Name: F9105J-LTR4-TNT-insertion-2
Description: F9105J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9105J-LTR4-TNT-insertion-2
[»] chr3 (3 HSPs)
chr3 (7-363)||(28750112-28750468)
chr3 (120-351)||(28740453-28740684)
chr3 (160-312)||(51122623-51122775)
[»] chr5 (1 HSPs)
chr5 (121-363)||(39942277-39942518)
[»] chr2 (3 HSPs)
chr2 (159-351)||(34947074-34947266)
chr2 (159-273)||(30013090-30013204)
chr2 (159-273)||(30072815-30072929)

Alignment Details
Target: chr3 (Bit Score: 353; Significance: 0; HSPs: 3)
Name: chr3

Target: chr3; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 7 - 363
Target Start/End: Original strand, 28750112 - 28750468
7 aacattaaattaaaactaaatgtttggactcattctcatcttatagttcattcatagaaaagatatatgtcatgcaatgcaaacaaatatttcaatgcaa 106  Q
28750112 aacattaaattaaaactaaatgtttggactcattctcatcttatagttcattcatagaaaagatatatgtcatgcaatgcaaacaaatatttcaatgcaa 28750211  T
107 aattcaaataattaagttagtgtacctttcggagtggaagcactgaaaagagaccaagaaagctaacaacaaatagaaatgcaatcatccatcctaaacc 206  Q
28750212 aattcaaataattaagttagtgtacctttcggagtggaagcactgaaaagagaccaagaaagctaacaacaaatagaaatgcaatcatccatcctaaacc 28750311  T
207 aagactcttaacgtcattggcactgtcaaattctggaatttgttttgcaatagttggactcattccaaacaagtagctaccaaacccacctacacaaaca 306  Q
28750312 aagactcttaacgtcattggcactgtcaaattctggaatttgttttgcaatagttggactcattccaaacaagtagctaccaaacccacctacacaaaca 28750411  T
307 aatcaagtaaaatacttgtcaaaaacaaacaagatcattgtatcatcactgcaatta 363  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
28750412 aatcaagtaaaatatttgtcaaaaacaaacaagatcattgtatcatcactgcaatta 28750468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 120 - 351
Target Start/End: Original strand, 28740453 - 28740684
120 aagttagtgtacctttcggagtggaagcactgaaaagagaccaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacg 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||     
28740453 aagttagtgtacctttcggagtggaagcactgaaaagagaccaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagaatcttaaca 28740552  T
220 tcattggcactgtcaaattctggaatttgttttgcaatagttggactcattccaaacaagtagctaccaaacccacctacacaaacaaatcaagtaaaat 319  Q
    ||||||| ||  ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| | |||||||||||||||    
28740553 tcattggaaccatcaaattctggaatttgttttgcaatagttggagtcattccaaacaagtagctaccaaatccacctacacgagcaaatcaagtaaaat 28740652  T
320 acttgtcaaaaacaaacaagatcattgtatca 351  Q
    | ||||| | |||||| ||| |||||||||||    
28740653 atttgtcgacaacaaataaggtcattgtatca 28740684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 160 - 312
Target Start/End: Complemental strand, 51122775 - 51122623
160 ccaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacgtcattggcactgtcaaattctggaatttgttttgcaatag 259  Q
    |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||| || ||||||||||||||||||||||||||||||    
51122775 ccaagaaagctaacaacaaataaaaatgcaatcatccatcctaaatcaagactcttaacatcattgacagtgtcaaattctggaatttgttttgcaatag 51122676  T
260 ttggactcattccaaacaagtagctaccaaacccacctacacaaacaaatcaa 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||    
51122675 ttggactcattccaaacaagtagctaccaaacccacctacacaaaaaaatcaa 51122623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 171; Significance: 9e-92; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 121 - 363
Target Start/End: Complemental strand, 39942518 - 39942277
121 agttagtgtacctttcggagtggaagcactgaaaagagaccaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacgt 220  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |    
39942518 agttagtgtacctttcggagtggaaccactgaaaagagaccaagaaagctgacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacat 39942419  T
221 cattggcactgtcaaattctggaatttgttttgcaatagttggactcattccaaacaagtagctaccaaacccacctacacaaacaaatcaagtaaaata 320  Q
    |||||||| || ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |    
39942418 cattggcagtgccagcttctggaatttgttttgcaatagttggactcattccaaacaagtagctaccaaacccacctacacaagcaaat-aagtaaaaga 39942320  T
321 cttgtcaaaaacaaacaagatcattgtatcatcactgcaatta 363  Q
     ||||||| ||||||  || |||||||||||  ||||||||||    
39942319 tttgtcaacaacaaatgaggtcattgtatcagaactgcaatta 39942277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 141; Significance: 7e-74; HSPs: 3)
Name: chr2

Target: chr2; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 159 - 351
Target Start/End: Original strand, 34947074 - 34947266
159 accaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacgtcattggcactgtcaaattctggaatttgttttgcaata 258  Q
    |||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| ||||| ||| |||||||||||| ||||||||||||||||    
34947074 accaagaaagctaacaacaaatagaaatccaatcatccatcctaaacaaagactcttaacatcattagcagtgtcaaattctgaaatttgttttgcaata 34947173  T
259 gttggactcattccaaacaagtagctaccaaacccacctacacaaacaaatcaagtaaaatacttgtcaaaaacaaacaagatcattgtatca 351  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||||| |||||| ||| ||||| |||||    
34947174 gttggactcattccaaacaagtagctaccaaacccacctacacaaaaaaatcaagtaaaagacatgtcaacaacaaataaggtcattatatca 34947266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 159 - 273
Target Start/End: Complemental strand, 30013204 - 30013090
159 accaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacgtcattggcactgtcaaattctggaatttgttttgcaata 258  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||    
30013204 accaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagattcttaacatcattggcagtgtcaaattctggaatttgttttgcaata 30013105  T
259 gttggactcattcca 273  Q
30013104 gttggactcattcca 30013090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 159 - 273
Target Start/End: Complemental strand, 30072929 - 30072815
159 accaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagactcttaacgtcattggcactgtcaaattctggaatttgttttgcaata 258  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||    
30072929 accaagaaagctaacaacaaatagaaatgcaatcatccatcctaaaccaagattcttaacatcattggcagtgtcaaattctggaatttgttttgcaata 30072830  T
259 gttggactcattcca 273  Q
30072829 gttggactcattcca 30072815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC