View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9105J-LTR4-TNT-insertion-3 (Length: 448)

Name: F9105J-LTR4-TNT-insertion-3
Description: F9105J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9105J-LTR4-TNT-insertion-3
F9105J-LTR4-TNT-insertion-3
[»] chr3 (7 HSPs)
chr3 (10-441)||(40595841-40596272)
chr3 (60-427)||(40566475-40566839)
chr3 (20-159)||(40600755-40600894)
chr3 (20-248)||(40589624-40589855)
chr3 (20-248)||(40571347-40571575)
chr3 (20-159)||(40577859-40577998)
chr3 (300-440)||(40589438-40589578)
[»] chr2 (1 HSPs)
chr2 (20-427)||(2016798-2017199)


Alignment Details
Target: chr3 (Bit Score: 424; Significance: 0; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 424; E-Value: 0
Query Start/End: Original strand, 10 - 441
Target Start/End: Complemental strand, 40596272 - 40595841
Alignment:
10 atccatccctgcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtttgccttacatgcataagtggaaagatccttccg 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
40596272 atccatccctgcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtctgccttacatgcataagtggaaagatccttccg 40596173  T
110 agcttgctggcacgtttggttccctactgcccagtccaacaacacaggaaggttcctcttctttagcttttggaggtctgtgattgcaaagcggtaggct 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
40596172 agcttgctggcacgtttggttccctactgcccagtccaacaacacaggaaagttcctcttctttagcttttggaggtctgtgattgcaaagcggtaggct 40596073  T
210 ccattttccaccaaaaacgtataaccacatggattgaagggctgtactaatgcctgattattgttcaatccgtgttcagaaatataggcaacttccgtaa 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40596072 ccattttccaccaaaaacgtataaccacatggattgaagggctgtactaatgcctgattattgttcaatccgtgttcagaaatataggcaacttccgtaa 40595973  T
310 acacacgacctttgggtattgaaatctcacaacaacctgggccggaacaagattcattggccacaatatcactaagcctgttgcacaaggccacacatgc 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40595972 acacacgacctttgggtattgaaatctcacaacaacctgggccggaacaagattcattggccacaatatcactaagcctgttgcacaaggccacacatgc 40595873  T
410 agtggtgtatgtgtttcctttagaatcaattg 441  Q
    ||||||||||||||||||||||||||||||||    
40595872 agtggtgtatgtgtttcctttagaatcaattg 40595841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 60 - 427
Target Start/End: Complemental strand, 40566839 - 40566475
Alignment:
60 taacatttacttttgtttgccttacatgcataagtggaaagatccttccgagcttgctggcacgtttggttccctactgcccagtccaacaacacaggaa 159  Q
    |||||| |||||||| | ||||||||||||||| |||||||||| ||| |||| |||||||| ||||||||||||||||||||||| |||||||||||||    
40566839 taacatgtacttttgctggccttacatgcataattggaaagatcattctgagcatgctggcatgtttggttccctactgcccagtcgaacaacacaggaa 40566740  T
160 ggttcctcttctttagcttttggaggtctgtgattgcaaagcggtaggctccattttccaccaaaaacgtataaccacatggattgaagggctgtactaa 259  Q
      | | ||||||||| ||   |||||||||||  | | |||| ||||||||||||||| |||| ||| | ||||||||| ||||||||    |||||       
40566739 actccttcttctttaactcaaggaggtctgtggattcgaagctgtaggctccattttcaaccacaaaagaataaccacagggattgaaatcatgtac--- 40566643  T
260 tgcctga-ttattgttcaatccgtgttcagaaatataggcaacttccgtaaacacacgacctttgggtattgaaatctcacaacaacctgggccggaaca 358  Q
     | |||| | |||||| |||     | ||||| ||||||| |||||  | ||||||||||||| ||||||||||||||| |||||||| |  || || ||    
40566642 -gtctgagtgattgttgaatatacctgcagaagtataggccacttctctcaacacacgaccttggggtattgaaatctcgcaacaaccagtacctgagca 40566544  T
359 agattcattggccacaatatcactaagcctgttgcacaaggccacacatgcagtggtgtatgtgtttcc 427  Q
    ||||| | |||||| |||||||  |||||||||||| || ||||||||| | ||||||||  |||||||    
40566543 agattgactggccataatatcatcaagcctgttgcataaagccacacatcctgtggtgtagttgtttcc 40566475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 20 - 159
Target Start/End: Complemental strand, 40600894 - 40600755
Alignment:
20 gcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtttgccttacatgcataagtggaaagatccttccgagcttgctgg 119  Q
    |||||| || |||||||||||| ||| ||||| |||||| |||||| |||||||||  |||||||| ||||||||||||||||||||| ||||||| ||     
40600894 gcatctacaaaggtaaccagatctgtcagttgttgcatcgtaacatgtacttttgtcggccttacacgcataagtggaaagatccttctgagcttgatga 40600795  T
120 cacgtttggttccctactgcccagtccaacaacacaggaa 159  Q
    || |||||||||||||||||||||||||||||||||||||    
40600794 caagtttggttccctactgcccagtccaacaacacaggaa 40600755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 40589855 - 40589624
Alignment:
20 gcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtttgccttacatgcata---agtggaaagatccttccgagcttgc 116  Q
    |||| |||| |||||||||||||||   |||  |||||| |||||| ||||| ||| ||||||||| |||||   | | |||||||||||| ||||||||    
40589855 gcatttgcaaaggtaaccagatttgatggtttctgcatcgtaacatatacttctgtctgccttacaagcatacttacttgaaagatccttctgagcttgc 40589756  T
117 tggcacgtttggttccctactgcccagtccaacaacacaggaaggttcctcttctttagcttttggaggtctgtgattgcaaagcggtaggctccatttt 216  Q
    || || |||||||| |||||||||||||||||||||||||||| |||| |||||||||||||  ||||||||||| |||| ||   |||| |||||||||    
40589755 tgacaggtttggtttcctactgcccagtccaacaacacaggaaagttcttcttctttagcttggggaggtctgtggttgcgaaaatgtagtctccatttt 40589656  T
217 ccaccaaaaacgtataaccacatggattgaag 248  Q
    | || | |||   ||||||||| |||||||||    
40589655 caacaataaaaacataaccacacggattgaag 40589624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 40571575 - 40571347
Alignment:
20 gcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtttgccttacatgcataagtggaaagatccttccgagcttgctgg 119  Q
    ||||||||| ||||||||||||||||  |||  || ||| |||||| ||||||| |  ||||||||||||||| || |||||| |||| |||||||| ||    
40571575 gcatctgcaaaggtaaccagatttgttggttcctggatcgtaacatgtacttttctcggccttacatgcataattgaaaagattcttctgagcttgcagg 40571476  T
120 cacgtttggttccctactgcccagtccaacaacacaggaaggttcctcttctttagcttttggaggtctgtgattgcaaagcggtaggctccattttcca 219  Q
    || |||||||| ||||||| ||||| ||||||||||||||  | | | ||||| | |||  |||||||||    ||  |||| ||||| ||||||||| |    
40571475 catgtttggtttcctactgtccagttcaacaacacaggaaactccttattcttcaacttgaggaggtctgatcgtgttaagctgtaggatccattttcaa 40571376  T
220 ccaaaaacgtataaccacatggattgaag 248  Q
     |||||| | ||| |||||||||||||||    
40571375 tcaaaaaagcatagccacatggattgaag 40571347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 20 - 159
Target Start/End: Complemental strand, 40577998 - 40577859
Alignment:
20 gcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtttgccttacatgcataagtggaaagatccttccgagcttgctgg 119  Q
    ||||||||| ||||||||||||||||  |||  ||  || |||||| |||||||  | |||||||| |||||| ||||| ||| |||| |||||||| ||    
40577998 gcatctgcaaaggtaaccagatttgttggttcctgtttcgtaacatgtacttttaatggccttacaagcataattggaatgattcttctgagcttgcagg 40577899  T
120 cacgtttggttccctactgcccagtccaacaacacaggaa 159  Q
    || ||||| || ||||||  ||||||||||||||||||||    
40577898 catgtttgatttcctactttccagtccaacaacacaggaa 40577859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 440
Target Start/End: Complemental strand, 40589578 - 40589438
Alignment:
300 acttccgtaaacacacgacctttgggtattgaaatctcacaacaacctgggccggaacaagattcattggccacaatatcactaagcctgttgcacaagg 399  Q
    |||||||| ||||||||||||| |||||  |||||||  |||||||| || || |||||||| |||||||| || | ||||    ||||||||||| | |    
40589578 acttccgttaacacacgaccttggggtaccgaaatctggcaacaaccaggaccagaacaagactcattggcaacgagatcagcgtgcctgttgcaccaag 40589479  T
400 ccacacatgcagtggtgtatgtgtttcctttagaatcaatt 440  Q
    ||| |||| ||| ||||||  ||||||||| ||||||||||    
40589478 ccaaacatccagaggtgtagttgtttccttcagaatcaatt 40589438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 81; Significance: 6e-38; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 20 - 427
Target Start/End: Original strand, 2016798 - 2017199
Alignment:
20 gcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtttgccttacatgcataagtggaaagatccttccgagcttgctgg 119  Q
    ||||||||| |||||||||||||| | || |||   ||  |||||| ||||||||||  ||||||| |||||| | | |||||||||| |||||||||||    
2016798 gcatctgcaaaggtaaccagatttctcaggtgg---attgtaacatgtacttttgttgtccttacaggcataatttgcaagatccttctgagcttgctgg 2016894  T
120 cacgtttggttccctactgcccagtccaacaacacaggaaggttcctcttctttagcttttggaggtctgt-gattgcaaagcggtaggctccattttcc 218  Q
    ||||||||||||||||||||||||||||||||||||||||  | | ||||||  | |||  ||||||| || ||||  ||||  |||||||||||||||     
2016895 cacgtttggttccctactgcccagtccaacaacacaggaaattccttcttctccaacttgaggaggtccgtggattcgaaag-tgtaggctccattttca 2016993  T
219 accaaaaacgtataaccacatggattgaagggctgtactaatgcctgattattgttcaatccgtgttcagaaatataggcaacttccgtaaacacacgac 318  Q
    || ||||| | ||||||||| |||||||||   ||||||  ||  ||   |||||| ||| |   | ||| || | |||  |||| |   |||| | |||    
2016994 acaaaaaaagcataaccacaaggattgaagtcatgtactgctgagtg---attgttgaatgcacctacagtaacaaaggacactttctcgaacaaatgac 2017090  T
319 ctttgggtattgaaatctcacaacaacctgggccggaacaagattcattggccacaatatcactaagcctgttgcacaaggccacacatgcagtggtgta 418  Q
    |||  ||||||||||||| ||||||||| | |||||| ||||||||||||||||| |||||| ||| |||||||||||| |||| |||| | ||||||||    
2017091 cttgcggtattgaaatctgacaacaaccagtgccggagcaagattcattggccacgatatcattaaacctgttgcacaaagccaaacatcccgtggtgta 2017190  T
419 tgtgtttcc 427  Q
      |||||||    
2017191 gttgtttcc 2017199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC