View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9105J-LTR4-TNT-insertion-3 (Length: 448)

Name: F9105J-LTR4-TNT-insertion-3
Description: F9105J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9105J-LTR4-TNT-insertion-3
[»] chr3 (7 HSPs)
chr3 (10-441)||(40595841-40596272)
chr3 (60-427)||(40566475-40566839)
chr3 (20-159)||(40600755-40600894)
chr3 (20-248)||(40589624-40589855)
chr3 (20-248)||(40571347-40571575)
chr3 (20-159)||(40577859-40577998)
chr3 (300-440)||(40589438-40589578)
[»] chr2 (1 HSPs)
chr2 (20-427)||(2016798-2017199)

Alignment Details
Target: chr3 (Bit Score: 424; Significance: 0; HSPs: 7)
Name: chr3

Target: chr3; HSP #1
Raw Score: 424; E-Value: 0
Query Start/End: Original strand, 10 - 441
Target Start/End: Complemental strand, 40596272 - 40595841
10 atccatccctgcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtttgccttacatgcataagtggaaagatccttccg 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
40596272 atccatccctgcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtctgccttacatgcataagtggaaagatccttccg 40596173  T
110 agcttgctggcacgtttggttccctactgcccagtccaacaacacaggaaggttcctcttctttagcttttggaggtctgtgattgcaaagcggtaggct 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
40596172 agcttgctggcacgtttggttccctactgcccagtccaacaacacaggaaagttcctcttctttagcttttggaggtctgtgattgcaaagcggtaggct 40596073  T
210 ccattttccaccaaaaacgtataaccacatggattgaagggctgtactaatgcctgattattgttcaatccgtgttcagaaatataggcaacttccgtaa 309  Q
40596072 ccattttccaccaaaaacgtataaccacatggattgaagggctgtactaatgcctgattattgttcaatccgtgttcagaaatataggcaacttccgtaa 40595973  T
310 acacacgacctttgggtattgaaatctcacaacaacctgggccggaacaagattcattggccacaatatcactaagcctgttgcacaaggccacacatgc 409  Q
40595972 acacacgacctttgggtattgaaatctcacaacaacctgggccggaacaagattcattggccacaatatcactaagcctgttgcacaaggccacacatgc 40595873  T
410 agtggtgtatgtgtttcctttagaatcaattg 441  Q
40595872 agtggtgtatgtgtttcctttagaatcaattg 40595841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 60 - 427
Target Start/End: Complemental strand, 40566839 - 40566475
60 taacatttacttttgtttgccttacatgcataagtggaaagatccttccgagcttgctggcacgtttggttccctactgcccagtccaacaacacaggaa 159  Q
    |||||| |||||||| | ||||||||||||||| |||||||||| ||| |||| |||||||| ||||||||||||||||||||||| |||||||||||||    
40566839 taacatgtacttttgctggccttacatgcataattggaaagatcattctgagcatgctggcatgtttggttccctactgcccagtcgaacaacacaggaa 40566740  T
160 ggttcctcttctttagcttttggaggtctgtgattgcaaagcggtaggctccattttccaccaaaaacgtataaccacatggattgaagggctgtactaa 259  Q
      | | ||||||||| ||   |||||||||||  | | |||| ||||||||||||||| |||| ||| | ||||||||| ||||||||    |||||       
40566739 actccttcttctttaactcaaggaggtctgtggattcgaagctgtaggctccattttcaaccacaaaagaataaccacagggattgaaatcatgtac--- 40566643  T
260 tgcctga-ttattgttcaatccgtgttcagaaatataggcaacttccgtaaacacacgacctttgggtattgaaatctcacaacaacctgggccggaaca 358  Q
     | |||| | |||||| |||     | ||||| ||||||| |||||  | ||||||||||||| ||||||||||||||| |||||||| |  || || ||    
40566642 -gtctgagtgattgttgaatatacctgcagaagtataggccacttctctcaacacacgaccttggggtattgaaatctcgcaacaaccagtacctgagca 40566544  T
359 agattcattggccacaatatcactaagcctgttgcacaaggccacacatgcagtggtgtatgtgtttcc 427  Q
    ||||| | |||||| |||||||  |||||||||||| || ||||||||| | ||||||||  |||||||    
40566543 agattgactggccataatatcatcaagcctgttgcataaagccacacatcctgtggtgtagttgtttcc 40566475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 20 - 159
Target Start/End: Complemental strand, 40600894 - 40600755
20 gcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtttgccttacatgcataagtggaaagatccttccgagcttgctgg 119  Q
    |||||| || |||||||||||| ||| ||||| |||||| |||||| |||||||||  |||||||| ||||||||||||||||||||| ||||||| ||     
40600894 gcatctacaaaggtaaccagatctgtcagttgttgcatcgtaacatgtacttttgtcggccttacacgcataagtggaaagatccttctgagcttgatga 40600795  T
120 cacgtttggttccctactgcccagtccaacaacacaggaa 159  Q
    || |||||||||||||||||||||||||||||||||||||    
40600794 caagtttggttccctactgcccagtccaacaacacaggaa 40600755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 40589855 - 40589624
20 gcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtttgccttacatgcata---agtggaaagatccttccgagcttgc 116  Q
    |||| |||| |||||||||||||||   |||  |||||| |||||| ||||| ||| ||||||||| |||||   | | |||||||||||| ||||||||    
40589855 gcatttgcaaaggtaaccagatttgatggtttctgcatcgtaacatatacttctgtctgccttacaagcatacttacttgaaagatccttctgagcttgc 40589756  T
117 tggcacgtttggttccctactgcccagtccaacaacacaggaaggttcctcttctttagcttttggaggtctgtgattgcaaagcggtaggctccatttt 216  Q
    || || |||||||| |||||||||||||||||||||||||||| |||| |||||||||||||  ||||||||||| |||| ||   |||| |||||||||    
40589755 tgacaggtttggtttcctactgcccagtccaacaacacaggaaagttcttcttctttagcttggggaggtctgtggttgcgaaaatgtagtctccatttt 40589656  T
217 ccaccaaaaacgtataaccacatggattgaag 248  Q
    | || | |||   ||||||||| |||||||||    
40589655 caacaataaaaacataaccacacggattgaag 40589624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 40571575 - 40571347
20 gcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtttgccttacatgcataagtggaaagatccttccgagcttgctgg 119  Q
    ||||||||| ||||||||||||||||  |||  || ||| |||||| ||||||| |  ||||||||||||||| || |||||| |||| |||||||| ||    
40571575 gcatctgcaaaggtaaccagatttgttggttcctggatcgtaacatgtacttttctcggccttacatgcataattgaaaagattcttctgagcttgcagg 40571476  T
120 cacgtttggttccctactgcccagtccaacaacacaggaaggttcctcttctttagcttttggaggtctgtgattgcaaagcggtaggctccattttcca 219  Q
    || |||||||| ||||||| ||||| ||||||||||||||  | | | ||||| | |||  |||||||||    ||  |||| ||||| ||||||||| |    
40571475 catgtttggtttcctactgtccagttcaacaacacaggaaactccttattcttcaacttgaggaggtctgatcgtgttaagctgtaggatccattttcaa 40571376  T
220 ccaaaaacgtataaccacatggattgaag 248  Q
     |||||| | ||| |||||||||||||||    
40571375 tcaaaaaagcatagccacatggattgaag 40571347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 20 - 159
Target Start/End: Complemental strand, 40577998 - 40577859
20 gcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtttgccttacatgcataagtggaaagatccttccgagcttgctgg 119  Q
    ||||||||| ||||||||||||||||  |||  ||  || |||||| |||||||  | |||||||| |||||| ||||| ||| |||| |||||||| ||    
40577998 gcatctgcaaaggtaaccagatttgttggttcctgtttcgtaacatgtacttttaatggccttacaagcataattggaatgattcttctgagcttgcagg 40577899  T
120 cacgtttggttccctactgcccagtccaacaacacaggaa 159  Q
    || ||||| || ||||||  ||||||||||||||||||||    
40577898 catgtttgatttcctactttccagtccaacaacacaggaa 40577859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 440
Target Start/End: Complemental strand, 40589578 - 40589438
300 acttccgtaaacacacgacctttgggtattgaaatctcacaacaacctgggccggaacaagattcattggccacaatatcactaagcctgttgcacaagg 399  Q
    |||||||| ||||||||||||| |||||  |||||||  |||||||| || || |||||||| |||||||| || | ||||    ||||||||||| | |    
40589578 acttccgttaacacacgaccttggggtaccgaaatctggcaacaaccaggaccagaacaagactcattggcaacgagatcagcgtgcctgttgcaccaag 40589479  T
400 ccacacatgcagtggtgtatgtgtttcctttagaatcaatt 440  Q
    ||| |||| ||| ||||||  ||||||||| ||||||||||    
40589478 ccaaacatccagaggtgtagttgtttccttcagaatcaatt 40589438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 81; Significance: 6e-38; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 20 - 427
Target Start/End: Original strand, 2016798 - 2017199
20 gcatctgcagaggtaaccagatttgtgagttggtgcatcataacatttacttttgtttgccttacatgcataagtggaaagatccttccgagcttgctgg 119  Q
    ||||||||| |||||||||||||| | || |||   ||  |||||| ||||||||||  ||||||| |||||| | | |||||||||| |||||||||||    
2016798 gcatctgcaaaggtaaccagatttctcaggtgg---attgtaacatgtacttttgttgtccttacaggcataatttgcaagatccttctgagcttgctgg 2016894  T
120 cacgtttggttccctactgcccagtccaacaacacaggaaggttcctcttctttagcttttggaggtctgt-gattgcaaagcggtaggctccattttcc 218  Q
    ||||||||||||||||||||||||||||||||||||||||  | | ||||||  | |||  ||||||| || ||||  ||||  |||||||||||||||     
2016895 cacgtttggttccctactgcccagtccaacaacacaggaaattccttcttctccaacttgaggaggtccgtggattcgaaag-tgtaggctccattttca 2016993  T
219 accaaaaacgtataaccacatggattgaagggctgtactaatgcctgattattgttcaatccgtgttcagaaatataggcaacttccgtaaacacacgac 318  Q
    || ||||| | ||||||||| |||||||||   ||||||  ||  ||   |||||| ||| |   | ||| || | |||  |||| |   |||| | |||    
2016994 acaaaaaaagcataaccacaaggattgaagtcatgtactgctgagtg---attgttgaatgcacctacagtaacaaaggacactttctcgaacaaatgac 2017090  T
319 ctttgggtattgaaatctcacaacaacctgggccggaacaagattcattggccacaatatcactaagcctgttgcacaaggccacacatgcagtggtgta 418  Q
    |||  ||||||||||||| ||||||||| | |||||| ||||||||||||||||| |||||| ||| |||||||||||| |||| |||| | ||||||||    
2017091 cttgcggtattgaaatctgacaacaaccagtgccggagcaagattcattggccacgatatcattaaacctgttgcacaaagccaaacatcccgtggtgta 2017190  T
419 tgtgtttcc 427  Q
2017191 gttgtttcc 2017199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 93755 times since January 2019
Visitors: 2365