View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-1 (Length: 582)

Name: F9119J-LTR4-TNT-insertion-1
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9119J-LTR4-TNT-insertion-1
F9119J-LTR4-TNT-insertion-1
[»] chr4 (2 HSPs)
chr4 (8-572)||(24359354-24359918)
chr4 (57-110)||(43560553-43560606)
[»] chr2 (2 HSPs)
chr2 (14-183)||(41831719-41831888)
chr2 (14-121)||(42788996-42789103)
[»] chr3 (2 HSPs)
chr3 (15-183)||(9231906-9232074)
chr3 (54-94)||(34626721-34626761)
[»] chr1 (1 HSPs)
chr1 (54-142)||(37962862-37962950)
[»] chr8 (2 HSPs)
chr8 (55-97)||(5843139-5843181)
chr8 (55-97)||(5849881-5849923)
[»] chr5 (1 HSPs)
chr5 (60-116)||(1281333-1281389)


Alignment Details
Target: chr4 (Bit Score: 499; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 499; E-Value: 0
Query Start/End: Original strand, 8 - 572
Target Start/End: Complemental strand, 24359918 - 24359354
Alignment:
8 aaatagtggacaaggttgttggagtgatgttgctagaaatgctggattgcaaagatgtggaaaaagttgtaggttaagatggatcaattacttgaggcct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24359918 aaatagtggacaaggttgttggagtgatgttgctagaaatgctggattgcaaagatgtggaaaaagttgtaggttaagatggatcaattacttgaggcct 24359819  T
108 gatcttaaacgtggtgcattctcaccacaggaagaagaacatatcattcatttgcattcccttcttggaaacaggttcacttcacttttctacctagctc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24359818 gatcttaaacgtggtgcattctcaccacaggaagaagaacatatcattcatttgcattcccttcttggaaacaggttcacttcacttttctacctagctc 24359719  T
208 atcaatttatttatcttattagtaccaaatttatcttaatctgagaagataaccatttttacattggctccttaactcactatttagtggacataaagag 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24359718 atcaatttatttatcttattagtaccaaatttatcttaatctgagaagataaccatttttacattggctccttaactcactatttagtggacataaagag 24359619  T
308 atttcaactgtgaactaataattaatatttgtatgcaccaaacatgagtatgtataatatggaccacaaaaaatgttttaaagatggacttgaccannnn 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        
24359618 atttcaactgtgaactaataattaatatttgtatgcaccaaacatgagtatgtataatatggaccacaaaaaatgttttaaagatggacttgaccatttt 24359519  T
408 nnnaataaaatcatgaattttataataatnnnnnnngggtagagatgtagtatttcattaaaatttattaaaaaatgtaaatattcacctttatttttag 507  Q
       ||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24359518 tttaataaaatcatgaattttataataataaaaaaagggtagagatgtagtatttcattaaaatttattaaaaaatgtaaatattcacctttatttttag 24359419  T
508 agatttatatttgatacaccannnnnnnnctctcaagttatctcacctacatcaagaggtgaatt 572  Q
    |||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||    
24359418 agatttatatttgatacaccattttttttctctcaagttatctcacctacatcaagaggtgaatt 24359354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 57 - 110
Target Start/End: Complemental strand, 43560606 - 43560553
Alignment:
57 caaagatgtggaaaaagttgtaggttaagatggatcaattacttgaggcctgat 110  Q
    |||||||||||||| |||||||| || |||||||| || || ||||||||||||    
43560606 caaagatgtggaaagagttgtagattgagatggataaactatttgaggcctgat 43560553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 102; Significance: 2e-50; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 14 - 183
Target Start/End: Complemental strand, 41831888 - 41831719
Alignment:
14 tggacaaggttgttggagtgatgttgctagaaatgctggattgcaaagatgtggaaaaagttgtaggttaagatggatcaattacttgaggcctgatctt 113  Q
    ||||||||| |||||||||||||| || ||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||    
41831888 tggacaaggatgttggagtgatgtggcaagaaatgctggattggaaagatgtggcaaaagttgtaggctaagatggatcaattacttgaggcctgatctt 41831789  T
114 aaacgtggtgcattctcaccacaggaagaagaacatatcattcatttgcattcccttcttggaaacaggt 183  Q
    ||| | ||||| |||||| |||| ||||||||||  ||||| ||||| ||||| || |||||||||||||    
41831788 aaaagaggtgctttctcaacacaagaagaagaactcatcatccatttccattctctacttggaaacaggt 41831719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 14 - 121
Target Start/End: Complemental strand, 42789103 - 42788996
Alignment:
14 tggacaaggttgttggagtgatgttgctagaaatgctggattgcaaagatgtggaaaaagttgtaggttaagatggatcaattacttgaggcctgatctt 113  Q
    |||||| ||||||||||||  |||  ||| |  ||| ||| |||| ||||||||||||||||| ||||| |||||||| ||||| || || |||||| |     
42789103 tggacatggttgttggagttctgtccctaaacttgcaggactgcagagatgtggaaaaagttgcaggttgagatggataaattatttaagacctgatttg 42789004  T
114 aaacgtgg 121  Q
    ||||||||    
42789003 aaacgtgg 42788996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 53; Significance: 4e-21; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 15 - 183
Target Start/End: Original strand, 9231906 - 9232074
Alignment:
15 ggacaaggttgttggagtgatgttgctagaaatgctggattgcaaagatgtggaaaaagttgtaggttaagatggatcaattacttgaggcctgatctta 114  Q
    ||||||||||||||||||||  ||||||| ||||||||  | ||||||||||| ||||||||| |  |  | ||||| ||||||||||| ||||||||||    
9231906 ggacaaggttgttggagtgacattgctaggaatgctggtcttcaaagatgtggcaaaagttgtcgtcttcgttggattaattacttgagacctgatctta 9232005  T
115 aacgtggtgcattctcaccacaggaagaagaacatatcattcatttgcattcccttcttggaaacaggt 183  Q
    | || || || || || ||||| || |||||||  ||||||||||| || ||| ||||||| |||||||    
9232006 agcgcggcgcgttttcgccacaagaggaagaactcatcattcatttccactccattcttggcaacaggt 9232074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 54 - 94
Target Start/End: Complemental strand, 34626761 - 34626721
Alignment:
54 ttgcaaagatgtggaaaaagttgtaggttaagatggatcaa 94  Q
    ||||||||||||||||| |||||||| || |||||||||||    
34626761 ttgcaaagatgtggaaagagttgtagattgagatggatcaa 34626721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 54 - 142
Target Start/End: Original strand, 37962862 - 37962950
Alignment:
54 ttgcaaagatgtggaaaaagttgtaggttaagatggatcaattacttgaggcctgatcttaaacgtggtgcattctcaccacaggaaga 142  Q
    |||||||| ||||| || ||||| |||||||||||||| |||||||||||||||||| | ||| | || |||||||||| ||| |||||    
37962862 ttgcaaaggtgtgggaagagttgcaggttaagatggataaattacttgaggcctgatttgaaaagaggagcattctcacaacaagaaga 37962950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000005; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 5843181 - 5843139
Alignment:
55 tgcaaagatgtggaaaaagttgtaggttaagatggatcaatta 97  Q
    |||| |||||||||||||||||||| ||||||||||| |||||    
5843181 tgcagagatgtggaaaaagttgtagattaagatggataaatta 5843139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 5849923 - 5849881
Alignment:
55 tgcaaagatgtggaaaaagttgtaggttaagatggatcaatta 97  Q
    |||| |||||||||||||||||||| ||||||||||| |||||    
5849923 tgcagagatgtggaaaaagttgtagattaagatggataaatta 5849881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 60 - 116
Target Start/End: Original strand, 1281333 - 1281389
Alignment:
60 agatgtggaaaaagttgtaggttaagatggatcaattacttgaggcctgatcttaaa 116  Q
    ||||||||||| |||||||||||||||||||  ||||| || || |||||| |||||    
1281333 agatgtggaaagagttgtaggttaagatggacaaattatttaagtcctgatattaaa 1281389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC