View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-10 (Length: 483)

Name: F9119J-LTR4-TNT-insertion-10
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9119J-LTR4-TNT-insertion-10
F9119J-LTR4-TNT-insertion-10
[»] chr1 (1 HSPs)
chr1 (7-473)||(12119693-12120159)
[»] chr4 (1 HSPs)
chr4 (237-285)||(15038803-15038851)


Alignment Details
Target: chr1 (Bit Score: 467; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 467; E-Value: 0
Query Start/End: Original strand, 7 - 473
Target Start/End: Original strand, 12119693 - 12120159
Alignment:
7 agttaatgctttccttactaccttagcatctcgacttggaggatcatgcagccaaagtaacaatgctttctgaaaccaaacataaagacgtcatatagtt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12119693 agttaatgctttccttactaccttagcatctcgacttggaggatcatgcagccaaagtaacaatgctttctgaaaccaaacataaagacgtcatatagtt 12119792  T
107 aacctagtttgacgcggttagacgaagatataaggactcactaataaccacatgatcagagggagatcttatcataggtccaacgattttcaaacaatcg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12119793 aacctagtttgacgcggttagacgaagatataaggactcactaataaccacatgatcagagggagatcttatcataggtccaacgattttcaaacaatcg 12119892  T
207 gtcatattcaatgtttaaatgttgtgtgtttaattcaaaattagtaaatgcttaacttgcttgtagcgcaagtaactgataggatagagttcagttttct 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12119893 gtcatattcaatgtttaaatgttgtgtgtttaattcaaaattagtaaatgcttaacttgcttgtagcgcaagtaactgataggatagagttcagttttct 12119992  T
307 gttatggcagttagtttgttatttcggttatgtgcttgagcaaaaatagctcattgaagtggaatgataatttagtttctgaaatttaacgaaattctaa 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12119993 gttatggcagttagtttgttatttcggttatgtgcttgagcaaaaatagctcattgaagtggaatgataatttagtttctgaaatttaacgaaattctaa 12120092  T
407 aatggctcctaaaactgaaaatctttattcatattaaacttttctaattatttctagggctaaatta 473  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12120093 aatggctcctaaaactgaaaatctttattcatattaaacttttctaattatttctagggctaaatta 12120159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 237 - 285
Target Start/End: Complemental strand, 15038851 - 15038803
Alignment:
237 taattcaaaattagtaaatgcttaacttgcttgtagcgcaagtaactga 285  Q
    |||||||||| |||| |||| ||| ||||||||| ||||||||||||||    
15038851 taattcaaaaatagtcaatggttaccttgcttgtggcgcaagtaactga 15038803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC