View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-12 (Length: 164)

Name: F9119J-LTR4-TNT-insertion-12
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9119J-LTR4-TNT-insertion-12
[»] chr2 (5 HSPs)
chr2 (9-156)||(30670204-30670351)
chr2 (9-154)||(30633795-30633940)
chr2 (9-156)||(30661524-30661671)
chr2 (18-138)||(30659466-30659586)
chr2 (18-113)||(30659369-30659464)
[»] chr1 (1 HSPs)
chr1 (9-152)||(10411512-10411655)
[»] chr5 (3 HSPs)
chr5 (84-152)||(35753394-35753462)
chr5 (75-150)||(35374974-35375049)
chr5 (42-126)||(35405119-35405203)
[»] chr8 (1 HSPs)
chr8 (12-128)||(13563870-13563986)

Alignment Details
Target: chr2 (Bit Score: 144; Significance: 5e-76; HSPs: 5)
Name: chr2

Target: chr2; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 9 - 156
Target Start/End: Original strand, 30670204 - 30670351
9 tttggtagtattcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 108  Q
30670204 tttggtagtattcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 30670303  T
109 ccaacctcgctggattgcaagtgtttgataaatcatctaataatatta 156  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||    
30670304 ccaacctcactggattgcaagtgtttgataaatcatctaataatatta 30670351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 9 - 154
Target Start/End: Original strand, 30633795 - 30633940
9 tttggtagtattcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 108  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30633795 tttggtagtattccatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 30633894  T
109 ccaacctcgctggattgcaagtgtttgataaatcatctaataatat 154  Q
    |||||||| |||||||||||| |||||||| | |||||||||||||    
30633895 ccaacctcactggattgcaagcgtttgatatagcatctaataatat 30633940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 112; E-Value: 6e-57
Query Start/End: Original strand, 9 - 156
Target Start/End: Original strand, 30661524 - 30661671
9 tttggtagtattcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 108  Q
    ||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
30661524 tttggtagtattccatcaaatatagatctagtttttcccaatcttgaacaattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 30661623  T
109 ccaacctcgctggattgcaagtgtttgataaatcatctaataatatta 156  Q
    |||||||| || |||||||||||||||||| | | | |||||||||||    
30661624 ccaacctcactcgattgcaagtgtttgatatagcttataataatatta 30661671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 18 - 138
Target Start/End: Original strand, 30659466 - 30659586
18 attcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatatccaacctcg 117  Q
    |||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||     
30659466 attccatcaaatatagatctagtttttcccaatcttgaacaattctttataggatccaagcaaattagcgcaacttttccgtcttcaatatccaacctca 30659565  T
118 ctggattgcaagtgtttgata 138  Q
    |||||||||||| ||||||||    
30659566 ctggattgcaagagtttgata 30659586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 18 - 113
Target Start/End: Original strand, 30659369 - 30659464
18 attcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatatccaac 113  Q
    |||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||||    
30659369 attccatcaaatatagatctagtttttcccaatcttgaacaattctttataggatccaagcaaattagcgcaacttttccgtcttcaatatccaac 30659464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 9 - 152
Target Start/End: Complemental strand, 10411655 - 10411512
9 tttggtagtattcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 108  Q
    ||||||||||||| |||||||||| ||||||  |||||| ||||||||  |  |   ||||||  ||||||||| |||  | | |||||||||||| |||    
10411655 tttggtagtattccatcaaatataaatctcgcctttccccatcttgaaaaacacgcgataggaaataaccaaataagcagagcatttccgtcttcattat 10411556  T
109 ccaacctcgctggattgcaagtgtttgataaatcatctaataat 152  Q
    |||||||| |||  |||||| ||||||||| | ||| |||||||    
10411555 ccaacctcactgagttgcaattgtttgatataccatataataat 10411512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.0000000009; HSPs: 3)
Name: chr5

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.0000000009
Query Start/End: Original strand, 84 - 152
Target Start/End: Original strand, 35753394 - 35753462
84 agcgcaacttttccgtcttcaatatccaacctcgctggattgcaagtgtttgataaatcatctaataat 152  Q
    |||| ||||||||||||||||||||| |||||| ||| |||| | | |||||||| ||||| |||||||    
35753394 agcggaacttttccgtcttcaatatcaaacctcactgaattggatgcgtttgatatatcatataataat 35753462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 75 - 150
Target Start/End: Original strand, 35374974 - 35375049
75 aaccaaattagcgcaacttttccgtcttcaatatccaacctcgctggattgcaagtgtttgataaatcatctaata 150  Q
    |||||||| |||| | ||||||||| |||| ||||||||||| ||| |||| || ||||||||| ||||| |||||    
35374974 aaccaaataagcggaccttttccgttttcagtatccaacctcactgaattgaaaatgtttgatatatcatataata 35375049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 42 - 126
Target Start/End: Original strand, 35405119 - 35405203
42 tttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatatccaacctcgctggattgc 126  Q
    |||||||||||||||  ||| | | |||||  ||||||||| || | || |||||| |||||||||||||||||  |||||||||    
35405119 tttcccaatcttgaagtattttatgtaggaggtaaccaaataagtggaatttttccatcttcaatatccaaccttactggattgc 35405203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 12 - 128
Target Start/End: Original strand, 13563870 - 13563986
12 ggtagtattcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatatcca 111  Q
    |||||| ||| ||||||||  ||||| | |||||| |||||||||  ||||||  | |||   |||||||| |  | |||||||||||||||||| ||||    
13563870 ggtagtcttccatcaaatacggatcttgattttccaaatcttgaataattcttggtcggagagaaccaaataacgggaacttttccgtcttcaatctcca 13563969  T
112 acctcgctggattgcaa 128  Q
    ||||| ||| |||||||    
13563970 acctcactgaattgcaa 13563986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC