View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-12 (Length: 164)

Name: F9119J-LTR4-TNT-insertion-12
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9119J-LTR4-TNT-insertion-12
F9119J-LTR4-TNT-insertion-12
[»] chr2 (5 HSPs)
chr2 (9-156)||(30670204-30670351)
chr2 (9-154)||(30633795-30633940)
chr2 (9-156)||(30661524-30661671)
chr2 (18-138)||(30659466-30659586)
chr2 (18-113)||(30659369-30659464)
[»] chr1 (1 HSPs)
chr1 (9-152)||(10411512-10411655)
[»] chr5 (3 HSPs)
chr5 (84-152)||(35753394-35753462)
chr5 (75-150)||(35374974-35375049)
chr5 (42-126)||(35405119-35405203)
[»] chr8 (1 HSPs)
chr8 (12-128)||(13563870-13563986)


Alignment Details
Target: chr2 (Bit Score: 144; Significance: 5e-76; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 9 - 156
Target Start/End: Original strand, 30670204 - 30670351
Alignment:
9 tttggtagtattcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30670204 tttggtagtattcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 30670303  T
109 ccaacctcgctggattgcaagtgtttgataaatcatctaataatatta 156  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||    
30670304 ccaacctcactggattgcaagtgtttgataaatcatctaataatatta 30670351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 9 - 154
Target Start/End: Original strand, 30633795 - 30633940
Alignment:
9 tttggtagtattcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 108  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30633795 tttggtagtattccatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 30633894  T
109 ccaacctcgctggattgcaagtgtttgataaatcatctaataatat 154  Q
    |||||||| |||||||||||| |||||||| | |||||||||||||    
30633895 ccaacctcactggattgcaagcgtttgatatagcatctaataatat 30633940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 112; E-Value: 6e-57
Query Start/End: Original strand, 9 - 156
Target Start/End: Original strand, 30661524 - 30661671
Alignment:
9 tttggtagtattcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 108  Q
    ||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
30661524 tttggtagtattccatcaaatatagatctagtttttcccaatcttgaacaattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 30661623  T
109 ccaacctcgctggattgcaagtgtttgataaatcatctaataatatta 156  Q
    |||||||| || |||||||||||||||||| | | | |||||||||||    
30661624 ccaacctcactcgattgcaagtgtttgatatagcttataataatatta 30661671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 18 - 138
Target Start/End: Original strand, 30659466 - 30659586
Alignment:
18 attcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatatccaacctcg 117  Q
    |||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||     
30659466 attccatcaaatatagatctagtttttcccaatcttgaacaattctttataggatccaagcaaattagcgcaacttttccgtcttcaatatccaacctca 30659565  T
118 ctggattgcaagtgtttgata 138  Q
    |||||||||||| ||||||||    
30659566 ctggattgcaagagtttgata 30659586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 18 - 113
Target Start/End: Original strand, 30659369 - 30659464
Alignment:
18 attcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatatccaac 113  Q
    |||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||||    
30659369 attccatcaaatatagatctagtttttcccaatcttgaacaattctttataggatccaagcaaattagcgcaacttttccgtcttcaatatccaac 30659464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 9 - 152
Target Start/End: Complemental strand, 10411655 - 10411512
Alignment:
9 tttggtagtattcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatat 108  Q
    ||||||||||||| |||||||||| ||||||  |||||| ||||||||  |  |   ||||||  ||||||||| |||  | | |||||||||||| |||    
10411655 tttggtagtattccatcaaatataaatctcgcctttccccatcttgaaaaacacgcgataggaaataaccaaataagcagagcatttccgtcttcattat 10411556  T
109 ccaacctcgctggattgcaagtgtttgataaatcatctaataat 152  Q
    |||||||| |||  |||||| ||||||||| | ||| |||||||    
10411555 ccaacctcactgagttgcaattgtttgatataccatataataat 10411512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.0000000009; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.0000000009
Query Start/End: Original strand, 84 - 152
Target Start/End: Original strand, 35753394 - 35753462
Alignment:
84 agcgcaacttttccgtcttcaatatccaacctcgctggattgcaagtgtttgataaatcatctaataat 152  Q
    |||| ||||||||||||||||||||| |||||| ||| |||| | | |||||||| ||||| |||||||    
35753394 agcggaacttttccgtcttcaatatcaaacctcactgaattggatgcgtttgatatatcatataataat 35753462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 75 - 150
Target Start/End: Original strand, 35374974 - 35375049
Alignment:
75 aaccaaattagcgcaacttttccgtcttcaatatccaacctcgctggattgcaagtgtttgataaatcatctaata 150  Q
    |||||||| |||| | ||||||||| |||| ||||||||||| ||| |||| || ||||||||| ||||| |||||    
35374974 aaccaaataagcggaccttttccgttttcagtatccaacctcactgaattgaaaatgtttgatatatcatataata 35375049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 42 - 126
Target Start/End: Original strand, 35405119 - 35405203
Alignment:
42 tttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatatccaacctcgctggattgc 126  Q
    |||||||||||||||  ||| | | |||||  ||||||||| || | || |||||| |||||||||||||||||  |||||||||    
35405119 tttcccaatcttgaagtattttatgtaggaggtaaccaaataagtggaatttttccatcttcaatatccaaccttactggattgc 35405203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 12 - 128
Target Start/End: Original strand, 13563870 - 13563986
Alignment:
12 ggtagtattcaatcaaatatagatctcgtttttcccaatcttgaacgattctttataggatctaaccaaattagcgcaacttttccgtcttcaatatcca 111  Q
    |||||| ||| ||||||||  ||||| | |||||| |||||||||  ||||||  | |||   |||||||| |  | |||||||||||||||||| ||||    
13563870 ggtagtcttccatcaaatacggatcttgattttccaaatcttgaataattcttggtcggagagaaccaaataacgggaacttttccgtcttcaatctcca 13563969  T
112 acctcgctggattgcaa 128  Q
    ||||| ||| |||||||    
13563970 acctcactgaattgcaa 13563986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 94908 times since January 2019
Visitors: 2221