View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-13 (Length: 269)

Name: F9119J-LTR4-TNT-insertion-13
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9119J-LTR4-TNT-insertion-13
F9119J-LTR4-TNT-insertion-13
[»] chr3 (1 HSPs)
chr3 (10-260)||(42551932-42552182)
[»] chr5 (2 HSPs)
chr5 (181-265)||(18234198-18234282)
chr5 (12-108)||(18234033-18234129)
[»] scaffold0150 (2 HSPs)
scaffold0150 (83-115)||(1473-1505)
scaffold0150 (83-115)||(16639-16671)
[»] chr8 (1 HSPs)
chr8 (83-115)||(30866226-30866258)
[»] scaffold0018 (1 HSPs)
scaffold0018 (83-115)||(131471-131503)


Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 10 - 260
Target Start/End: Complemental strand, 42552182 - 42551932
Alignment:
10 ccacaatagcataccactttgacagagtgtctgggtcaccatcaactccaaacttacaagcaatagctatagctataacaatctacaaacaaaattcaaa 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42552182 ccacaatagcataccactttgacagagtgtctgggtcaccatcaactccaaacttacaagcaatagctatagctataacaatctacaaacaaaattcaaa 42552083  T
110 tttaattagtaacaagtaaactttacagttcaatatagtgtgtatgtatgtattgcaaataattttgttaaacaaacctgacaaatgaacatttgaatac 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42552082 tttaattagtaacaagtaaactttacagttcaatatagtgtgtatgtatgtattgcaaataattttgttaaacaaacctgacaaatgaacatttgaatac 42551983  T
210 ctccttcaatgaaaagagttcttcttccaaatttatcaacagtagcaattg 260  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
42551982 ctccttcaatgaaaagagttcttcttccaaatttatcaacagtagcaattg 42551932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 181 - 265
Target Start/End: Original strand, 18234198 - 18234282
Alignment:
181 acaaacctgacaaatgaacatttgaatacctccttcaatgaaaagagttcttcttccaaatttatcaacagtagcaattggtacg 265  Q
    ||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| || |||| ||||    
18234198 acaaacctgacaaataaacatttgaataccgccttctatgaaaagagttcttcttccaaatttatcaacagtggcgattgatacg 18234282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 108
Target Start/End: Original strand, 18234033 - 18234129
Alignment:
12 acaatagcataccactttgacagagtgtctgggtcaccatcaactccaaacttacaagcaatagctatagctataacaatctacaaacaaaattcaa 108  Q
    ||||| ||||||||||||| || |  | |||||||||||   |||||||| |||   ||||||  ||||||||||||||||| ||||||||||||||    
18234033 acaattgcataccactttggcaaaacgcctgggtcaccacttactccaaatttaagcgcaataaatatagctataacaatctgcaaacaaaattcaa 18234129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0150 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0150
Description:

Target: scaffold0150; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 83 - 115
Target Start/End: Original strand, 1473 - 1505
Alignment:
83 tataacaatctacaaacaaaattcaaatttaat 115  Q
    |||||||||||||||||||||||||||||||||    
1473 tataacaatctacaaacaaaattcaaatttaat 1505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0150; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 83 - 115
Target Start/End: Original strand, 16639 - 16671
Alignment:
83 tataacaatctacaaacaaaattcaaatttaat 115  Q
    |||||||||||||||||||||||||||||||||    
16639 tataacaatctacaaacaaaattcaaatttaat 16671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 83 - 115
Target Start/End: Original strand, 30866226 - 30866258
Alignment:
83 tataacaatctacaaacaaaattcaaatttaat 115  Q
    |||||||||||||||||||||||||||||||||    
30866226 tataacaatctacaaacaaaattcaaatttaat 30866258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 83 - 115
Target Start/End: Complemental strand, 131503 - 131471
Alignment:
83 tataacaatctacaaacaaaattcaaatttaat 115  Q
    ||||||||||| |||||||||||||||||||||    
131503 tataacaatctgcaaacaaaattcaaatttaat 131471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC